Incidental Mutation 'R6733:Unk'
ID530155
Institutional Source Beutler Lab
Gene Symbol Unk
Ensembl Gene ENSMUSG00000020770
Gene Nameunkempt family zinc finger
SynonymsZc3h5, B230379M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R6733 (G1)
Quality Score188.009
Status Not validated
Chromosome11
Chromosomal Location116030322-116061214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116050755 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 276 (D276G)
Ref Sequence ENSEMBL: ENSMUSP00000102060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000106452]
Predicted Effect probably damaging
Transcript: ENSMUST00000021116
AA Change: D276G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770
AA Change: D276G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106452
AA Change: D276G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770
AA Change: D276G

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176212
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Unk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Unk APN 11 116058379 missense probably benign 0.44
IGL01956:Unk APN 11 116056334 missense probably damaging 1.00
IGL02044:Unk APN 11 116049328 missense probably damaging 0.99
IGL02738:Unk APN 11 116056191 missense probably damaging 1.00
IGL02861:Unk APN 11 116056299 missense possibly damaging 0.58
legal_midget UTSW 11 116050724 missense probably damaging 1.00
produce UTSW 11 116051459 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0827:Unk UTSW 11 116053109 missense possibly damaging 0.59
R1471:Unk UTSW 11 116049409 missense probably benign 0.45
R1824:Unk UTSW 11 116030442 unclassified probably benign
R1900:Unk UTSW 11 116059081 missense probably benign 0.01
R3052:Unk UTSW 11 116050123 missense probably benign 0.01
R4033:Unk UTSW 11 116053527 missense probably benign 0.00
R4449:Unk UTSW 11 116053634 missense probably damaging 1.00
R4593:Unk UTSW 11 116049056 missense probably benign 0.02
R4847:Unk UTSW 11 116054406 missense probably damaging 1.00
R4921:Unk UTSW 11 116054945 missense probably benign
R4940:Unk UTSW 11 116053665 missense possibly damaging 0.63
R5099:Unk UTSW 11 116059110 missense probably benign 0.00
R5838:Unk UTSW 11 116049331 missense probably damaging 1.00
R6351:Unk UTSW 11 116054946 missense probably benign
R6387:Unk UTSW 11 116054940 missense possibly damaging 0.88
R6551:Unk UTSW 11 116050724 missense probably damaging 1.00
R6554:Unk UTSW 11 116051459 missense probably damaging 1.00
R6599:Unk UTSW 11 116047802 missense probably damaging 1.00
R7743:Unk UTSW 11 116049436 missense possibly damaging 0.74
R7765:Unk UTSW 11 116053082 missense probably benign 0.25
Z1176:Unk UTSW 11 116047764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGAGACCCTTCCTCTATAGCTGATC -3'
(R):5'- AAGCTGTCCTCACATCTGCC -3'

Sequencing Primer
(F):5'- TACCTATTTCTGTACCTGGACTTGAG -3'
(R):5'- ACATCTGCCTCGCTATGCTG -3'
Posted On2018-08-01