Incidental Mutation 'R6733:Sgpp1'
ID530156
Institutional Source Beutler Lab
Gene Symbol Sgpp1
Ensembl Gene ENSMUSG00000021054
Gene Namesphingosine-1-phosphate phosphatase 1
SynonymsSPP1, mSPP1, SPP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6733 (G1)
Quality Score139.008
Status Not validated
Chromosome12
Chromosomal Location75714249-75735729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 75735469 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 32 (P32R)
Ref Sequence ENSEMBL: ENSMUSP00000151268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021450] [ENSMUST00000220285]
Predicted Effect probably benign
Transcript: ENSMUST00000021450
AA Change: P32R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021450
Gene: ENSMUSG00000021054
AA Change: P32R

DomainStartEndE-ValueType
low complexity region 47 63 N/A INTRINSIC
acidPPc 150 264 1.5e-8 SMART
transmembrane domain 279 298 N/A INTRINSIC
transmembrane domain 346 368 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220285
AA Change: P32R

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP1 catalyzes the degradation of S1P via salvage and recycling of sphingosine into long-chain ceramides (Mandala et al., 2000 [PubMed 10859351]; Le Stunff et al., 2007 [PubMed 17895250]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal keratinocyte differentiation and epidermal homeostasis with postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Sgpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgpp1 APN 12 75716194 nonsense probably null
IGL01348:Sgpp1 APN 12 75734993 missense probably damaging 1.00
IGL01481:Sgpp1 APN 12 75722657 missense probably benign 0.31
IGL03384:Sgpp1 APN 12 75716106 unclassified probably benign
R0597:Sgpp1 UTSW 12 75735100 missense probably damaging 1.00
R1203:Sgpp1 UTSW 12 75716282 missense probably benign 0.07
R1648:Sgpp1 UTSW 12 75716216 missense possibly damaging 0.94
R1842:Sgpp1 UTSW 12 75716208 missense probably damaging 1.00
R1932:Sgpp1 UTSW 12 75716179 nonsense probably null
R1958:Sgpp1 UTSW 12 75735448 missense probably benign 0.00
R2098:Sgpp1 UTSW 12 75716510 missense probably damaging 1.00
R4034:Sgpp1 UTSW 12 75716190 missense probably damaging 1.00
R4730:Sgpp1 UTSW 12 75734939 missense probably benign
R5531:Sgpp1 UTSW 12 75735207 nonsense probably null
R6775:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6778:Sgpp1 UTSW 12 75716294 missense probably benign 0.00
R6783:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6784:Sgpp1 UTSW 12 75735469 missense probably benign 0.22
R6928:Sgpp1 UTSW 12 75716570 missense probably damaging 1.00
R7381:Sgpp1 UTSW 12 75716264 missense probably damaging 1.00
R7805:Sgpp1 UTSW 12 75722677 missense probably damaging 0.97
R8113:Sgpp1 UTSW 12 75716600 missense probably damaging 0.97
RF043:Sgpp1 UTSW 12 75722625 frame shift probably null
X0018:Sgpp1 UTSW 12 75716518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCACTTTGACCAGCTCG -3'
(R):5'- TTCTTCGCACAGCAACCAGG -3'

Sequencing Primer
(F):5'- TCGCCCGTCAACGAGTTG -3'
(R):5'- AGCAACCAGGAGCACCGG -3'
Posted On2018-08-01