Incidental Mutation 'R6733:Rsl1'
ID530158
Institutional Source Beutler Lab
Gene Symbol Rsl1
Ensembl Gene ENSMUSG00000058900
Gene Nameregulator of sex limited protein 1
Synonymsrslcan-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67173182-67184044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67177142 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000021997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021997] [ENSMUST00000225334]
Predicted Effect probably benign
Transcript: ENSMUST00000021997
AA Change: T81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021997
Gene: ENSMUSG00000058900
AA Change: T81A

DomainStartEndE-ValueType
KRAB 15 75 2.67e-33 SMART
ZnF_C2H2 119 141 1.92e-2 SMART
ZnF_C2H2 147 169 1.6e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.69e-3 SMART
ZnF_C2H2 259 281 3.83e-2 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 8.94e-3 SMART
ZnF_C2H2 371 393 9.44e-2 SMART
ZnF_C2H2 399 421 3.58e-2 SMART
ZnF_C2H2 427 449 5.5e-3 SMART
ZnF_C2H2 455 477 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225334
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Rsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Rsl1 APN 13 67181798 missense probably benign 0.04
IGL01120:Rsl1 APN 13 67177166 splice site probably benign
IGL02041:Rsl1 APN 13 67176548 missense probably damaging 1.00
IGL02316:Rsl1 APN 13 67177056 splice site probably null
IGL02632:Rsl1 APN 13 67182163 missense probably damaging 0.97
IGL02645:Rsl1 APN 13 67182209 missense probably benign 0.00
R0097:Rsl1 UTSW 13 67181902 missense probably damaging 0.99
R1644:Rsl1 UTSW 13 67177165 splice site probably benign
R2040:Rsl1 UTSW 13 67182081 missense probably damaging 1.00
R2206:Rsl1 UTSW 13 67182828 missense probably benign
R2207:Rsl1 UTSW 13 67182828 missense probably benign
R4235:Rsl1 UTSW 13 67177162 critical splice donor site probably null
R4995:Rsl1 UTSW 13 67182249 missense possibly damaging 0.60
R5118:Rsl1 UTSW 13 67181981 missense probably damaging 1.00
R6748:Rsl1 UTSW 13 67182624 missense probably benign 0.00
R7397:Rsl1 UTSW 13 67182037 missense possibly damaging 0.57
R7531:Rsl1 UTSW 13 67176502 missense possibly damaging 0.92
R7729:Rsl1 UTSW 13 67182220 missense possibly damaging 0.95
R7963:Rsl1 UTSW 13 67182109 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTGAAGGAACTAATTGTCTGCAG -3'
(R):5'- ACACAGGGCACACTGTTTG -3'

Sequencing Primer
(F):5'- TGTTCTCCAACCAGGTCT -3'
(R):5'- GGCACACTGTTTGCAAAATATAAATC -3'
Posted On2018-08-01