Incidental Mutation 'R6733:Il25'
ID530160
Institutional Source Beutler Lab
Gene Symbol Il25
Ensembl Gene ENSMUSG00000040770
Gene Nameinterleukin 25
SynonymsIl17e, IL-17E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location54932695-54935837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54933033 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 21 (I21T)
Ref Sequence ENSEMBL: ENSMUSP00000039641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037814] [ENSMUST00000037863] [ENSMUST00000227441]
Predicted Effect probably benign
Transcript: ENSMUST00000037814
SMART Domains Protein: ENSMUSP00000036138
Gene: ENSMUSG00000040759

DomainStartEndE-ValueType
transmembrane domain 35 56 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
transmembrane domain 119 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037863
AA Change: I21T

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000039641
Gene: ENSMUSG00000040770
AA Change: I21T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:IL17 77 163 4.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226807
Predicted Effect probably benign
Transcript: ENSMUST00000227441
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. Studies of a similar gene in mice suggest that this cytokine may be a pro-inflammatory cytokine favoring the Th2-type immune response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele have increased susceptibility to parasitic infection. Male homozygous mutant mice exhibit notably increased mean serum triglyceride levels in another null allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Il25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03327:Il25 APN 14 54935360 unclassified probably benign
R0035:Il25 UTSW 14 54933096 missense probably damaging 0.99
R0368:Il25 UTSW 14 54935174 splice site probably null
R1212:Il25 UTSW 14 54932755 unclassified probably benign
R7044:Il25 UTSW 14 54933158 missense probably benign
R7464:Il25 UTSW 14 54933222 missense probably null 1.00
R7488:Il25 UTSW 14 54933002 missense probably benign
Z1177:Il25 UTSW 14 54935207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGACAGAGGAATGGCTG -3'
(R):5'- TAGCTCCAAGGAGAGATGGC -3'

Sequencing Primer
(F):5'- AAGGCTAGGCTTCCAGGC -3'
(R):5'- AGAGATGGCCCTGCTGTTGAG -3'
Posted On2018-08-01