Incidental Mutation 'R6733:Zfp942'
ID530162
Institutional Source Beutler Lab
Gene Symbol Zfp942
Ensembl Gene ENSMUSG00000071267
Gene Namezinc finger protein 942
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21926960-21962464 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 21928752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 299 (E299*)
Ref Sequence ENSEMBL: ENSMUSP00000089494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074295] [ENSMUST00000091879]
Predicted Effect probably null
Transcript: ENSMUST00000074295
AA Change: E299*
SMART Domains Protein: ENSMUSP00000073907
Gene: ENSMUSG00000071267
AA Change: E299*

DomainStartEndE-ValueType
KRAB 13 69 6.55e-19 SMART
ZnF_C2H2 183 205 1.16e-1 SMART
ZnF_C2H2 211 233 8.22e-2 SMART
ZnF_C2H2 239 261 5.14e-3 SMART
ZnF_C2H2 267 289 8.02e-5 SMART
ZnF_C2H2 295 317 2.32e-1 SMART
ZnF_C2H2 323 345 1.6e-4 SMART
ZnF_C2H2 351 373 8.94e-3 SMART
ZnF_C2H2 379 401 1.95e-3 SMART
ZnF_C2H2 407 429 2.24e-3 SMART
ZnF_C2H2 435 457 7.49e-5 SMART
ZnF_C2H2 463 485 2.99e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091879
AA Change: E299*
SMART Domains Protein: ENSMUSP00000089494
Gene: ENSMUSG00000071267
AA Change: E299*

DomainStartEndE-ValueType
KRAB 13 69 6.55e-19 SMART
ZnF_C2H2 183 205 1.16e-1 SMART
ZnF_C2H2 211 233 8.22e-2 SMART
ZnF_C2H2 239 261 5.14e-3 SMART
ZnF_C2H2 267 289 8.02e-5 SMART
ZnF_C2H2 295 317 2.32e-1 SMART
ZnF_C2H2 323 345 1.6e-4 SMART
ZnF_C2H2 351 373 8.94e-3 SMART
ZnF_C2H2 379 401 1.95e-3 SMART
ZnF_C2H2 407 429 2.24e-3 SMART
ZnF_C2H2 435 457 7.49e-5 SMART
ZnF_C2H2 463 485 2.99e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc22a8 T C 19: 8,609,292 L389P probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Zfp942
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Zfp942 APN 17 21929061 missense probably benign
IGL00586:Zfp942 APN 17 21928624 missense probably damaging 1.00
IGL02973:Zfp942 APN 17 21932991 critical splice donor site probably null
IGL03212:Zfp942 APN 17 21929464 nonsense probably null
IGL03382:Zfp942 APN 17 21929102 missense probably benign 0.04
R0008:Zfp942 UTSW 17 21928338 missense probably damaging 1.00
R0113:Zfp942 UTSW 17 21929085 missense probably benign 0.18
R0244:Zfp942 UTSW 17 21928572 missense probably benign 0.02
R0369:Zfp942 UTSW 17 21929036 missense probably benign 0.41
R1664:Zfp942 UTSW 17 21928439 missense possibly damaging 0.83
R1824:Zfp942 UTSW 17 21928541 missense probably damaging 1.00
R4545:Zfp942 UTSW 17 21928304 missense probably benign 0.00
R4785:Zfp942 UTSW 17 21929419 missense probably damaging 1.00
R5493:Zfp942 UTSW 17 21933004 missense probably null 0.66
R6568:Zfp942 UTSW 17 21929062 missense probably benign 0.14
R7650:Zfp942 UTSW 17 21928837 missense probably benign 0.07
R7935:Zfp942 UTSW 17 21929227 nonsense probably null
R8065:Zfp942 UTSW 17 21930410 missense probably damaging 0.96
R8067:Zfp942 UTSW 17 21930410 missense probably damaging 0.96
R8237:Zfp942 UTSW 17 21928245 missense possibly damaging 0.92
R8513:Zfp942 UTSW 17 21928301 missense probably benign
X0025:Zfp942 UTSW 17 21929307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCGTAGGTAAAGCATTTGTCAC -3'
(R):5'- CTTGGGCTGAAACAAACCAATAG -3'

Sequencing Primer
(F):5'- GGTAAAGCATTTGTCACATTCACTAC -3'
(R):5'- GTGAATGTTCCAGATGCTTCACCAAG -3'
Posted On2018-08-01