Incidental Mutation 'R6733:Slc22a8'
ID530163
Institutional Source Beutler Lab
Gene Symbol Slc22a8
Ensembl Gene ENSMUSG00000063796
Gene Namesolute carrier family 22 (organic anion transporter), member 8
SynonymsRoct, mOat3, OAT3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6733 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8591254-8611834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8609292 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 389 (L389P)
Ref Sequence ENSEMBL: ENSMUSP00000131045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010251] [ENSMUST00000170817]
Predicted Effect probably benign
Transcript: ENSMUST00000010251
AA Change: L389P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000010251
Gene: ENSMUSG00000063796
AA Change: L389P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 73 506 6.8e-33 PFAM
Pfam:MFS_1 97 461 6.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170817
AA Change: L389P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131045
Gene: ENSMUSG00000063796
AA Change: L389P

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:Sugar_tr 78 507 6.7e-34 PFAM
Pfam:MFS_1 97 461 6.8e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in the sodium-independent transport and excretion of organic anions, some of which are potentially toxic. The encoded protein is an integral membrane protein and appears to be localized to the basolateral membrane of the kidney. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased urinary urate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,930,530 S155P probably damaging Het
Afdn C T 17: 13,823,353 H358Y probably benign Het
Ccdc125 T A 13: 100,694,487 M394K probably benign Het
Cfd C A 10: 79,891,802 H103Q probably damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Dedd2 T C 7: 25,203,907 E209G probably benign Het
Dnah3 A G 7: 119,922,974 S3999P probably benign Het
Fer1l5 T C 1: 36,408,672 probably null Het
H6pd A T 4: 149,985,121 probably null Het
Il25 T C 14: 54,933,033 I21T probably benign Het
Kmt2c C T 5: 25,409,293 S143N probably damaging Het
Marveld3 T C 8: 109,962,049 D20G possibly damaging Het
Msl1 A G 11: 98,800,056 E122G probably damaging Het
Obscn A T 11: 59,028,595 V6861E probably damaging Het
Olfr1447 A T 19: 12,901,241 C180S probably damaging Het
Phc1 A T 6: 122,336,886 M29K possibly damaging Het
Pkd1l3 T A 8: 109,648,494 probably null Het
Prl5a1 G T 13: 28,149,936 V141F possibly damaging Het
Psg20 A T 7: 18,674,622 V391D probably damaging Het
Ptprh T C 7: 4,603,044 probably null Het
Rasa3 T C 8: 13,580,037 E580G possibly damaging Het
Ror1 T C 4: 100,426,055 V439A probably benign Het
Rsl1 A G 13: 67,177,142 T81A probably benign Het
Sgpp1 G C 12: 75,735,469 P32R probably benign Het
Slc6a11 A G 6: 114,134,898 Y142C probably damaging Het
Syt9 C T 7: 107,425,296 T132I probably damaging Het
Thop1 T A 10: 81,081,412 I583N probably damaging Het
Tom1l1 A G 11: 90,685,060 probably null Het
Unk A G 11: 116,050,755 D276G probably damaging Het
Zfp942 C A 17: 21,928,752 E299* probably null Het
Zkscan6 A G 11: 65,828,635 T494A probably damaging Het
Zscan25 T A 5: 145,290,913 probably null Het
Other mutations in Slc22a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Slc22a8 APN 19 8594135 missense probably benign 0.37
IGL00679:Slc22a8 APN 19 8604855 missense possibly damaging 0.54
IGL00717:Slc22a8 APN 19 8609929 missense probably benign 0.02
IGL00974:Slc22a8 APN 19 8609926 missense probably damaging 1.00
IGL01104:Slc22a8 APN 19 8607965 missense possibly damaging 0.62
IGL01975:Slc22a8 APN 19 8605411 missense probably damaging 0.96
IGL02025:Slc22a8 APN 19 8594175 missense possibly damaging 0.65
IGL02353:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02360:Slc22a8 APN 19 8608255 missense possibly damaging 0.78
IGL02535:Slc22a8 APN 19 8610203 missense probably benign
IGL02639:Slc22a8 APN 19 8593959 missense probably benign
IGL03167:Slc22a8 APN 19 8609958 missense probably damaging 1.00
IGL03368:Slc22a8 APN 19 8609119 splice site probably benign
R0333:Slc22a8 UTSW 19 8608150 splice site probably benign
R1290:Slc22a8 UTSW 19 8609911 missense probably damaging 1.00
R1773:Slc22a8 UTSW 19 8594229 missense probably damaging 1.00
R1861:Slc22a8 UTSW 19 8606139 missense probably damaging 1.00
R2516:Slc22a8 UTSW 19 8610195 missense probably benign
R2988:Slc22a8 UTSW 19 8610248 missense probably benign 0.00
R3914:Slc22a8 UTSW 19 8608186 missense probably damaging 1.00
R4206:Slc22a8 UTSW 19 8608233 missense probably benign 0.00
R5092:Slc22a8 UTSW 19 8594164 missense probably damaging 1.00
R5463:Slc22a8 UTSW 19 8609274 missense probably benign 0.00
R5470:Slc22a8 UTSW 19 8607870 missense probably damaging 1.00
R7009:Slc22a8 UTSW 19 8605417 missense probably benign 0.05
R7642:Slc22a8 UTSW 19 8610045 missense probably benign 0.00
R7684:Slc22a8 UTSW 19 8609930 missense probably benign 0.00
R7689:Slc22a8 UTSW 19 8607884 missense probably damaging 0.96
R7729:Slc22a8 UTSW 19 8593959 missense possibly damaging 0.95
R7879:Slc22a8 UTSW 19 8594022 missense probably benign 0.11
R8030:Slc22a8 UTSW 19 8610007 missense probably damaging 0.99
R8113:Slc22a8 UTSW 19 8605539 missense probably benign 0.00
R8280:Slc22a8 UTSW 19 8609263 nonsense probably null
R8509:Slc22a8 UTSW 19 8607975 critical splice donor site probably null
Z1176:Slc22a8 UTSW 19 8593922 missense probably benign 0.10
Z1177:Slc22a8 UTSW 19 8605423 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCTGACCAATGCCTCTCTG -3'
(R):5'- GAATCCATCTGCTACTCCTAGTGC -3'

Sequencing Primer
(F):5'- GTCTCTCAGGTTTGCTACTGGC -3'
(R):5'- GAGTTGTTTCCTACAAGAATAACCCG -3'
Posted On2018-08-01