Incidental Mutation 'R6735:Zbtb49'
ID530174
Institutional Source Beutler Lab
Gene Symbol Zbtb49
Ensembl Gene ENSMUSG00000029127
Gene Namezinc finger and BTB domain containing 49
SynonymsZfp509, 4930518A03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38189735-38220457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38201058 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 617 (M617K)
Ref Sequence ENSEMBL: ENSMUSP00000092429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094833] [ENSMUST00000123106] [ENSMUST00000126267] [ENSMUST00000136475] [ENSMUST00000138820] [ENSMUST00000143436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094833
AA Change: M617K

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092429
Gene: ENSMUSG00000029127
AA Change: M617K

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
ZnF_C2H2 414 436 6.99e-5 SMART
ZnF_C2H2 442 464 2.24e-3 SMART
ZnF_C2H2 470 492 1.26e-2 SMART
ZnF_C2H2 498 520 5.14e-3 SMART
ZnF_C2H2 526 548 2.27e-4 SMART
ZnF_C2H2 554 576 3.39e-3 SMART
low complexity region 597 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123106
SMART Domains Protein: ENSMUSP00000144200
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 12 51 1.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124939
Predicted Effect probably benign
Transcript: ENSMUST00000126267
SMART Domains Protein: ENSMUSP00000122109
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129161
Predicted Effect probably benign
Transcript: ENSMUST00000136475
SMART Domains Protein: ENSMUSP00000117174
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
BTB 25 121 2.97e-23 SMART
ZnF_C2H2 386 408 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138820
SMART Domains Protein: ENSMUSP00000117913
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 13 63 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143436
SMART Domains Protein: ENSMUSP00000115513
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
Pfam:BTB 15 75 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146859
SMART Domains Protein: ENSMUSP00000114955
Gene: ENSMUSG00000029127

DomainStartEndE-ValueType
ZnF_C2H2 11 33 1.26e-2 SMART
ZnF_C2H2 39 61 5.14e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Zbtb49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Zbtb49 APN 5 38210616 critical splice donor site probably null
IGL01736:Zbtb49 APN 5 38200860 missense probably damaging 1.00
PIT4585001:Zbtb49 UTSW 5 38216476 missense probably damaging 1.00
R0443:Zbtb49 UTSW 5 38200830 missense probably benign 0.08
R0526:Zbtb49 UTSW 5 38213919 missense probably benign 0.08
R0646:Zbtb49 UTSW 5 38200674 missense probably damaging 1.00
R1200:Zbtb49 UTSW 5 38213331 missense probably damaging 1.00
R1678:Zbtb49 UTSW 5 38213694 missense probably damaging 0.97
R1964:Zbtb49 UTSW 5 38203761 nonsense probably null
R2155:Zbtb49 UTSW 5 38214120 missense possibly damaging 0.86
R2483:Zbtb49 UTSW 5 38203357 intron probably benign
R3617:Zbtb49 UTSW 5 38200631 unclassified probably benign
R4937:Zbtb49 UTSW 5 38213963 missense possibly damaging 0.76
R5579:Zbtb49 UTSW 5 38200816 missense probably damaging 0.99
R5699:Zbtb49 UTSW 5 38216526 missense probably damaging 1.00
R6354:Zbtb49 UTSW 5 38203559 missense possibly damaging 0.58
R6426:Zbtb49 UTSW 5 38203087 unclassified probably null
R6805:Zbtb49 UTSW 5 38213241 intron probably benign
R6869:Zbtb49 UTSW 5 38214350 missense probably damaging 1.00
R7020:Zbtb49 UTSW 5 38213367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCACATCTGAGTACGCGTAGG -3'
(R):5'- CTATAGCTGTGAGGTCTGCAG -3'

Sequencing Primer
(F):5'- AGTACGCGTAGGCCTGTG -3'
(R):5'- AGGTCTGCAGCAAGTGTTTCAC -3'
Posted On2018-08-01