Mutagenetix > Incidental Mutation

Incidental Mutation 'R6735:Arhgef5'

530179

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

044853-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43275032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 906 (S906P)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably benign
Transcript: ENSMUST00000031750
AA Change: S906P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: S906P

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: S174P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.1074

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,855,900	H230Q	probably benign	Het
2510039O18Rik	A	G	4: 147,941,817	T265A	probably benign	Het
Adap1	A	T	5: 139,293,145	Y127N	probably damaging	Het
Alg8	T	C	7: 97,382,982	F246S	probably benign	Het
Alpk1	A	G	3: 127,724,449	Y68H	probably damaging	Het
C9	A	T	15: 6,489,906	D408V	probably benign	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Cpeb4	T	A	11: 31,924,700	Y174N	probably benign	Het
Enpp3	A	G	10: 24,807,453	Y289H	probably damaging	Het
Erbin	A	T	13: 103,884,210	D80E	probably damaging	Het
Fgd6	A	T	10: 94,074,320	E829V	possibly damaging	Het
Foxn2	T	G	17: 88,486,795	S387A	probably benign	Het
H2afy2	A	G	10: 61,741,267	I274T	probably damaging	Het
Kif13a	A	G	13: 46,752,746	S574P	possibly damaging	Het
Lhx6	T	G	2: 36,091,378	D67A	probably damaging	Het
Lmbr1l	A	T	15: 98,909,240	M220K	probably damaging	Het
Lrmp	T	C	6: 145,160,893	L201S	probably damaging	Het
Naa35	T	C	13: 59,625,564	L111P	probably damaging	Het
Notch2	T	A	3: 98,134,586	V1307E	probably damaging	Het
Nts	T	A	10: 102,484,998	M77L	probably benign	Het
Olfr1029	A	C	2: 85,975,434	S64R	possibly damaging	Het
Pigz	A	G	16: 31,945,543	N473S	probably benign	Het
Pkd2	A	G	5: 104,480,329	D423G	probably damaging	Het
Plac8	A	G	5: 100,562,619		probably null	Het
Ppp2r2b	T	C	18: 42,688,588		probably null	Het
Proc	T	C	18: 32,123,648	N322S	probably benign	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Psd3	A	G	8: 68,120,746		probably null	Het
Safb	A	G	17: 56,585,169		probably benign	Het
Scnn1g	A	G	7: 121,742,263	D216G	probably benign	Het
Sept7	A	G	9: 25,303,752	E345G	possibly damaging	Het
Sult2a5	A	T	7: 13,665,058	K197*	probably null	Het
Suv39h1	C	A	X: 8,062,899	R397L	probably damaging	Homo
Thbs4	T	A	13: 92,755,166	M814L	possibly damaging	Het
Tmem14a	T	A	1: 21,229,581		probably benign	Het
Tmprss11d	C	A	5: 86,309,300	A167S	probably damaging	Het
Ttn	C	A	2: 76,798,908	C14362F	probably damaging	Het
Usp15	T	C	10: 123,168,367	I161V	possibly damaging	Het
Vmn1r67	T	C	7: 10,447,211	L134P	probably damaging	Het
Wdr74	A	G	19: 8,736,222	E73G	possibly damaging	Het
Zbtb49	A	T	5: 38,201,058	M617K	possibly damaging	Het
Zc3h3	G	A	15: 75,756,634	T937I	probably benign	Het
Zeb2	C	T	2: 45,110,016	V25M	probably null	Het
Zfp108	T	C	7: 24,261,772	F596S	probably damaging	Het
Zfyve1	T	A	12: 83,594,844	N13Y	possibly damaging	Het
Zswim2	T	C	2: 83,923,761	D185G	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGATGTATAGGCCTCTACCCC -3'
(R):5'- GATCCTAAAGCTGACCTCCTTG -3'

Sequencing Primer
(F):5'- ATTGCCCCCAAAGTCCAGGG -3'
(R):5'- AGCCCTGACTCATCCTTA -3'

Posted On

2018-08-01