Incidental Mutation 'R6735:Alg8'
ID530184
Institutional Source Beutler Lab
Gene Symbol Alg8
Ensembl Gene ENSMUSG00000035704
Gene Nameasparagine-linked glycosylation 8 (alpha-1,3-glucosyltransferase)
SynonymsLOC381903
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97371606-97392185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97382982 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 246 (F246S)
Ref Sequence ENSEMBL: ENSMUSP00000095901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098300]
Predicted Effect probably benign
Transcript: ENSMUST00000098300
AA Change: F246S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095901
Gene: ENSMUSG00000035704
AA Change: F246S

DomainStartEndE-ValueType
Pfam:Alg6_Alg8 21 510 1.3e-165 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154107
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALG6/ALG8 glucosyltransferase family. The encoded protein catalyzes the addition of the second glucose residue to the lipid-linked oligosaccharide precursor for N-linked glycosylation of proteins. Mutations in this gene have been associated with congenital disorder of glycosylation type Ih (CDG-Ih). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Alg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Alg8 APN 7 97378176 missense possibly damaging 0.81
IGL02349:Alg8 APN 7 97379894 missense possibly damaging 0.95
IGL02441:Alg8 APN 7 97380297 missense probably benign 0.04
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0238:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R0239:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1109:Alg8 UTSW 7 97383684 critical splice acceptor site probably null
R1429:Alg8 UTSW 7 97390292 missense probably benign 0.18
R3838:Alg8 UTSW 7 97388545 missense probably damaging 1.00
R5343:Alg8 UTSW 7 97386919 missense possibly damaging 0.53
R5622:Alg8 UTSW 7 97386799 splice site probably benign
R5910:Alg8 UTSW 7 97390286 missense possibly damaging 0.67
R5963:Alg8 UTSW 7 97379830 missense probably benign 0.00
R6484:Alg8 UTSW 7 97382928 missense probably benign
R7896:Alg8 UTSW 7 97390916 missense probably damaging 1.00
R7979:Alg8 UTSW 7 97390916 missense probably damaging 1.00
Z1176:Alg8 UTSW 7 97383761 missense probably benign 0.01
Z1177:Alg8 UTSW 7 97371662 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGAGTACACCCAGGCATG -3'
(R):5'- ACTTGAACATGCACAGTGATGTG -3'

Sequencing Primer
(F):5'- TACACCCAGGCATGGTGCAG -3'
(R):5'- GAACACTCCACCGTATGTTGGTAG -3'
Posted On2018-08-01