Mutagenetix > Incidental Mutation

Incidental Mutation 'R6735:Scnn1g'

530185

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R6735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121742263 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 216 (D216G)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably benign
Transcript: ENSMUST00000000221
AA Change: D216G

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: D216G

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,855,900	H230Q	probably benign	Het
2510039O18Rik	A	G	4: 147,941,817	T265A	probably benign	Het
Adap1	A	T	5: 139,293,145	Y127N	probably damaging	Het
Alg8	T	C	7: 97,382,982	F246S	probably benign	Het
Alpk1	A	G	3: 127,724,449	Y68H	probably damaging	Het
Arhgef5	T	C	6: 43,275,032	S906P	probably benign	Het
C9	A	T	15: 6,489,906	D408V	probably benign	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Cpeb4	T	A	11: 31,924,700	Y174N	probably benign	Het
Enpp3	A	G	10: 24,807,453	Y289H	probably damaging	Het
Erbin	A	T	13: 103,884,210	D80E	probably damaging	Het
Fgd6	A	T	10: 94,074,320	E829V	possibly damaging	Het
Foxn2	T	G	17: 88,486,795	S387A	probably benign	Het
H2afy2	A	G	10: 61,741,267	I274T	probably damaging	Het
Kif13a	A	G	13: 46,752,746	S574P	possibly damaging	Het
Lhx6	T	G	2: 36,091,378	D67A	probably damaging	Het
Lmbr1l	A	T	15: 98,909,240	M220K	probably damaging	Het
Lrmp	T	C	6: 145,160,893	L201S	probably damaging	Het
Naa35	T	C	13: 59,625,564	L111P	probably damaging	Het
Notch2	T	A	3: 98,134,586	V1307E	probably damaging	Het
Nts	T	A	10: 102,484,998	M77L	probably benign	Het
Olfr1029	A	C	2: 85,975,434	S64R	possibly damaging	Het
Pigz	A	G	16: 31,945,543	N473S	probably benign	Het
Pkd2	A	G	5: 104,480,329	D423G	probably damaging	Het
Plac8	A	G	5: 100,562,619		probably null	Het
Ppp2r2b	T	C	18: 42,688,588		probably null	Het
Proc	T	C	18: 32,123,648	N322S	probably benign	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Psd3	A	G	8: 68,120,746		probably null	Het
Safb	A	G	17: 56,585,169		probably benign	Het
Sept7	A	G	9: 25,303,752	E345G	possibly damaging	Het
Sult2a5	A	T	7: 13,665,058	K197*	probably null	Het
Suv39h1	C	A	X: 8,062,899	R397L	probably damaging	Homo
Thbs4	T	A	13: 92,755,166	M814L	possibly damaging	Het
Tmem14a	T	A	1: 21,229,581		probably benign	Het
Tmprss11d	C	A	5: 86,309,300	A167S	probably damaging	Het
Ttn	C	A	2: 76,798,908	C14362F	probably damaging	Het
Usp15	T	C	10: 123,168,367	I161V	possibly damaging	Het
Vmn1r67	T	C	7: 10,447,211	L134P	probably damaging	Het
Wdr74	A	G	19: 8,736,222	E73G	possibly damaging	Het
Zbtb49	A	T	5: 38,201,058	M617K	possibly damaging	Het
Zc3h3	G	A	15: 75,756,634	T937I	probably benign	Het
Zeb2	C	T	2: 45,110,016	V25M	probably null	Het
Zfp108	T	C	7: 24,261,772	F596S	probably damaging	Het
Zfyve1	T	A	12: 83,594,844	N13Y	possibly damaging	Het
Zswim2	T	C	2: 83,923,761	D185G	probably benign	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCTGACCTCAATGTCCGAC -3'
(R):5'- AGTCCTTAGAGAGTGTCCCTTCC -3'

Sequencing Primer
(F):5'- GACCTCAATGTCCGACTTTGC -3'
(R):5'- AGAGAGTGTCCCTTCCTGACCTG -3'

Posted On

2018-08-01