Incidental Mutation 'R6735:Enpp3'
ID 530188
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
MMRRC Submission 044853-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6735 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24683351 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 289 (Y289H)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]
AlphaFold Q6DYE8
Predicted Effect probably damaging
Transcript: ENSMUST00000020169
AA Change: Y289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: Y289H

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218619
Predicted Effect probably benign
Transcript: ENSMUST00000219342
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 148,026,274 (GRCm39) T265A probably benign Het
Adap1 A T 5: 139,278,900 (GRCm39) Y127N probably damaging Het
Alg8 T C 7: 97,032,189 (GRCm39) F246S probably benign Het
Alpk1 A G 3: 127,518,098 (GRCm39) Y68H probably damaging Het
Arhgef5 T C 6: 43,251,966 (GRCm39) S906P probably benign Het
C9 A T 15: 6,519,387 (GRCm39) D408V probably benign Het
Cnot2 G A 10: 116,334,058 (GRCm39) P371S possibly damaging Het
Cpeb4 T A 11: 31,874,700 (GRCm39) Y174N probably benign Het
Erbin A T 13: 104,020,718 (GRCm39) D80E probably damaging Het
Fgd6 A T 10: 93,910,182 (GRCm39) E829V possibly damaging Het
Foxn2 T G 17: 88,794,223 (GRCm39) S387A probably benign Het
Hapstr1 T A 16: 8,673,764 (GRCm39) H230Q probably benign Het
Irag2 T C 6: 145,106,619 (GRCm39) L201S probably damaging Het
Kif13a A G 13: 46,906,222 (GRCm39) S574P possibly damaging Het
Lhx6 T G 2: 35,981,390 (GRCm39) D67A probably damaging Het
Lmbr1l A T 15: 98,807,121 (GRCm39) M220K probably damaging Het
Macroh2a2 A G 10: 61,577,046 (GRCm39) I274T probably damaging Het
Naa35 T C 13: 59,773,378 (GRCm39) L111P probably damaging Het
Notch2 T A 3: 98,041,902 (GRCm39) V1307E probably damaging Het
Nts T A 10: 102,320,859 (GRCm39) M77L probably benign Het
Or5m11b A C 2: 85,805,778 (GRCm39) S64R possibly damaging Het
Pigz A G 16: 31,764,361 (GRCm39) N473S probably benign Het
Pkd2 A G 5: 104,628,195 (GRCm39) D423G probably damaging Het
Plac8 A G 5: 100,710,485 (GRCm39) probably null Het
Ppp2r2b T C 18: 42,821,653 (GRCm39) probably null Het
Proc T C 18: 32,256,701 (GRCm39) N322S probably benign Het
Prpf40b C T 15: 99,212,784 (GRCm39) R627W probably damaging Het
Psd3 A G 8: 68,573,398 (GRCm39) probably null Het
Safb A G 17: 56,892,169 (GRCm39) probably benign Het
Scnn1g A G 7: 121,341,486 (GRCm39) D216G probably benign Het
Septin7 A G 9: 25,215,048 (GRCm39) E345G possibly damaging Het
Sult2a5 A T 7: 13,398,983 (GRCm39) K197* probably null Het
Suv39h1 C A X: 7,929,138 (GRCm39) R397L probably damaging Homo
Thbs4 T A 13: 92,891,674 (GRCm39) M814L possibly damaging Het
Tmem14a T A 1: 21,299,805 (GRCm39) probably benign Het
Tmprss11d C A 5: 86,457,159 (GRCm39) A167S probably damaging Het
Ttn C A 2: 76,629,252 (GRCm39) C14362F probably damaging Het
Usp15 T C 10: 123,004,272 (GRCm39) I161V possibly damaging Het
Vmn1r67 T C 7: 10,181,138 (GRCm39) L134P probably damaging Het
Wdr74 A G 19: 8,713,586 (GRCm39) E73G possibly damaging Het
Zbtb49 A T 5: 38,358,402 (GRCm39) M617K possibly damaging Het
Zc3h3 G A 15: 75,628,483 (GRCm39) T937I probably benign Het
Zeb2 C T 2: 45,000,028 (GRCm39) V25M probably null Het
Zfp108 T C 7: 23,961,197 (GRCm39) F596S probably damaging Het
Zfyve1 T A 12: 83,641,618 (GRCm39) N13Y possibly damaging Het
Zswim2 T C 2: 83,754,105 (GRCm39) D185G probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9224:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCTGAATCCAGAACCTGTATG -3'
(R):5'- CAGTCAAAATAGTTGTTAGCAGGAG -3'

Sequencing Primer
(F):5'- CCTGTATGATAGAAGAGAACTGACCC -3'
(R):5'- AGCAGGAGGTTATAGTGTTCATTC -3'
Posted On 2018-08-01