Mutagenetix > Incidental Mutation

Incidental Mutation 'R6735:Enpp3'

530188

Institutional Source

Beutler Lab

Gene Symbol

Enpp3

Ensembl Gene

ENSMUSG00000019989

Gene Name

ectonucleotide pyrophosphatase/phosphodiesterase 3

Synonyms

CD203c

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.138) question?

Stock #

R6735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24772406-24842823 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24807453 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 289 (Y289H)

Ref Sequence

ENSEMBL: ENSMUSP00000020169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020169] [ENSMUST00000217903] [ENSMUST00000219342]

AlphaFold

Q6DYE8

Predicted Effect

probably damaging
Transcript: ENSMUST00000020169
AA Change: Y289H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: Y289H

Domain	Start	End	E-Value	Type
transmembrane domain	23	45	N/A	INTRINSIC
SO	50	93	1.99e-13	SMART
SO	94	137	7.66e-15	SMART
Pfam:Phosphodiest	161	485	1.7e-87	PFAM
Blast:Endonuclease_NS	543	599	9e-15	BLAST
Endonuclease_NS	626	847	5.41e-16	SMART
NUC	627	856	1.54e-92	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000217903

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218619

Predicted Effect

probably benign
Transcript: ENSMUST00000219342

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,855,900	H230Q	probably benign	Het
2510039O18Rik	A	G	4: 147,941,817	T265A	probably benign	Het
Adap1	A	T	5: 139,293,145	Y127N	probably damaging	Het
Alg8	T	C	7: 97,382,982	F246S	probably benign	Het
Alpk1	A	G	3: 127,724,449	Y68H	probably damaging	Het
Arhgef5	T	C	6: 43,275,032	S906P	probably benign	Het
C9	A	T	15: 6,489,906	D408V	probably benign	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Cpeb4	T	A	11: 31,924,700	Y174N	probably benign	Het
Erbin	A	T	13: 103,884,210	D80E	probably damaging	Het
Fgd6	A	T	10: 94,074,320	E829V	possibly damaging	Het
Foxn2	T	G	17: 88,486,795	S387A	probably benign	Het
H2afy2	A	G	10: 61,741,267	I274T	probably damaging	Het
Kif13a	A	G	13: 46,752,746	S574P	possibly damaging	Het
Lhx6	T	G	2: 36,091,378	D67A	probably damaging	Het
Lmbr1l	A	T	15: 98,909,240	M220K	probably damaging	Het
Lrmp	T	C	6: 145,160,893	L201S	probably damaging	Het
Naa35	T	C	13: 59,625,564	L111P	probably damaging	Het
Notch2	T	A	3: 98,134,586	V1307E	probably damaging	Het
Nts	T	A	10: 102,484,998	M77L	probably benign	Het
Olfr1029	A	C	2: 85,975,434	S64R	possibly damaging	Het
Pigz	A	G	16: 31,945,543	N473S	probably benign	Het
Pkd2	A	G	5: 104,480,329	D423G	probably damaging	Het
Plac8	A	G	5: 100,562,619		probably null	Het
Ppp2r2b	T	C	18: 42,688,588		probably null	Het
Proc	T	C	18: 32,123,648	N322S	probably benign	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Psd3	A	G	8: 68,120,746		probably null	Het
Safb	A	G	17: 56,585,169		probably benign	Het
Scnn1g	A	G	7: 121,742,263	D216G	probably benign	Het
Sept7	A	G	9: 25,303,752	E345G	possibly damaging	Het
Sult2a5	A	T	7: 13,665,058	K197*	probably null	Het
Suv39h1	C	A	X: 8,062,899	R397L	probably damaging	Homo
Thbs4	T	A	13: 92,755,166	M814L	possibly damaging	Het
Tmem14a	T	A	1: 21,229,581		probably benign	Het
Tmprss11d	C	A	5: 86,309,300	A167S	probably damaging	Het
Ttn	C	A	2: 76,798,908	C14362F	probably damaging	Het
Usp15	T	C	10: 123,168,367	I161V	possibly damaging	Het
Vmn1r67	T	C	7: 10,447,211	L134P	probably damaging	Het
Wdr74	A	G	19: 8,736,222	E73G	possibly damaging	Het
Zbtb49	A	T	5: 38,201,058	M617K	possibly damaging	Het
Zc3h3	G	A	15: 75,756,634	T937I	probably benign	Het
Zeb2	C	T	2: 45,110,016	V25M	probably null	Het
Zfp108	T	C	7: 24,261,772	F596S	probably damaging	Het
Zfyve1	T	A	12: 83,594,844	N13Y	possibly damaging	Het
Zswim2	T	C	2: 83,923,761	D185G	probably benign	Het

Other mutations in Enpp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Enpp3	APN	10	24787772	missense	probably benign	0.00
IGL00778:Enpp3	APN	10	24798262	missense	probably damaging	1.00
IGL01147:Enpp3	APN	10	24774907	missense	probably damaging	1.00
IGL01343:Enpp3	APN	10	24805922	nonsense	probably null
IGL01642:Enpp3	APN	10	24798269	missense	probably damaging	1.00
IGL01814:Enpp3	APN	10	24792025	missense	possibly damaging	0.68
IGL02083:Enpp3	APN	10	24776794	missense	probably damaging	1.00
IGL02152:Enpp3	APN	10	24774002	missense	probably damaging	1.00
IGL02186:Enpp3	APN	10	24791983	splice site	probably benign
IGL02517:Enpp3	APN	10	24809848	splice site	probably benign
IGL02956:Enpp3	APN	10	24774943	splice site	probably benign
R0017:Enpp3	UTSW	10	24799153	splice site	probably null
R0042:Enpp3	UTSW	10	24774824	missense	probably damaging	1.00
R0110:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0218:Enpp3	UTSW	10	24776869	missense	possibly damaging	0.80
R0403:Enpp3	UTSW	10	24804436	missense	probably damaging	1.00
R0433:Enpp3	UTSW	10	24820597	missense	probably benign	0.00
R0450:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0510:Enpp3	UTSW	10	24776781	missense	probably damaging	1.00
R0826:Enpp3	UTSW	10	24795716	missense	probably damaging	1.00
R1245:Enpp3	UTSW	10	24784953	splice site	probably benign
R1261:Enpp3	UTSW	10	24774934	missense	probably damaging	0.97
R1633:Enpp3	UTSW	10	24795782	missense	probably damaging	1.00
R1903:Enpp3	UTSW	10	24778789	missense	probably damaging	1.00
R1913:Enpp3	UTSW	10	24776771	nonsense	probably null
R1966:Enpp3	UTSW	10	24807491	missense	probably damaging	0.99
R2157:Enpp3	UTSW	10	24776878	missense	probably damaging	1.00
R2179:Enpp3	UTSW	10	24805895	missense	probably benign	0.00
R2380:Enpp3	UTSW	10	24776872	missense	probably benign
R2410:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R3794:Enpp3	UTSW	10	24831732	splice site	probably null
R3896:Enpp3	UTSW	10	24777949	missense	possibly damaging	0.79
R4334:Enpp3	UTSW	10	24793589	missense	probably damaging	1.00
R4569:Enpp3	UTSW	10	24776882	missense	probably damaging	1.00
R4766:Enpp3	UTSW	10	24773927	missense	probably damaging	1.00
R4951:Enpp3	UTSW	10	24798277	missense	probably damaging	1.00
R4998:Enpp3	UTSW	10	24807538	missense	probably benign	0.01
R5045:Enpp3	UTSW	10	24776767	missense	probably damaging	1.00
R5276:Enpp3	UTSW	10	24809916	missense	probably damaging	1.00
R5331:Enpp3	UTSW	10	24808160	missense	probably damaging	1.00
R5569:Enpp3	UTSW	10	24778821	missense	probably damaging	0.98
R5975:Enpp3	UTSW	10	24774842	missense	probably benign	0.37
R6117:Enpp3	UTSW	10	24787852	missense	probably damaging	1.00
R6419:Enpp3	UTSW	10	24808191	missense	probably damaging	1.00
R6677:Enpp3	UTSW	10	24777957	missense	possibly damaging	0.88
R6833:Enpp3	UTSW	10	24809870	missense	probably damaging	1.00
R6999:Enpp3	UTSW	10	24808166	missense	probably damaging	1.00
R7022:Enpp3	UTSW	10	24826195	missense	probably damaging	0.99
R7173:Enpp3	UTSW	10	24774047	missense	probably damaging	1.00
R7224:Enpp3	UTSW	10	24776884	missense	possibly damaging	0.63
R7227:Enpp3	UTSW	10	24817844	missense	unknown
R7487:Enpp3	UTSW	10	24805923	missense	probably benign	0.02
R7529:Enpp3	UTSW	10	24798174	missense	probably damaging	0.97
R7583:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R7692:Enpp3	UTSW	10	24784841	nonsense	probably null
R7962:Enpp3	UTSW	10	24784854	missense	probably damaging	1.00
R7965:Enpp3	UTSW	10	24778819	missense	possibly damaging	0.90
R8153:Enpp3	UTSW	10	24809879	missense	probably damaging	1.00
R8262:Enpp3	UTSW	10	24777926	missense	probably damaging	1.00
R8305:Enpp3	UTSW	10	24824929	critical splice acceptor site	probably null
R8393:Enpp3	UTSW	10	24826241	missense	probably damaging	1.00
R8776:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8776-TAIL:Enpp3	UTSW	10	24774835	missense	probably damaging	1.00
R8962:Enpp3	UTSW	10	24820615	missense	probably benign	0.12
R9047:Enpp3	UTSW	10	24798274	missense	possibly damaging	0.83
R9093:Enpp3	UTSW	10	24795804	missense	probably benign	0.00
R9117:Enpp3	UTSW	10	24826180	missense	possibly damaging	0.67
R9194:Enpp3	UTSW	10	24799194	missense	possibly damaging	0.90
R9224:Enpp3	UTSW	10	24774818	missense	probably benign	0.00
R9244:Enpp3	UTSW	10	24778791	missense	probably damaging	1.00
R9387:Enpp3	UTSW	10	24836092	start codon destroyed	probably null	0.83
R9644:Enpp3	UTSW	10	24809903	missense	probably damaging	0.98
R9658:Enpp3	UTSW	10	24773904	makesense	probably null
X0026:Enpp3	UTSW	10	24826242	missense	probably damaging	1.00
Z1176:Enpp3	UTSW	10	24787793	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCTGAATCCAGAACCTGTATG -3'
(R):5'- CAGTCAAAATAGTTGTTAGCAGGAG -3'

Sequencing Primer
(F):5'- CCTGTATGATAGAAGAGAACTGACCC -3'
(R):5'- AGCAGGAGGTTATAGTGTTCATTC -3'

Posted On

2018-08-01