Incidental Mutation 'R6735:Cnot2'
ID530192
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene NameCCR4-NOT transcription complex, subunit 2
Synonyms2810470K03Rik, 2600016M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R6735 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location116485161-116581511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116498153 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 371 (P371S)
Ref Sequence ENSEMBL: ENSMUSP00000132152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169576] [ENSMUST00000169921]
Predicted Effect probably benign
Transcript: ENSMUST00000105265
AA Change: P286S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166
AA Change: P286S

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105267
AA Change: P371S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: P371S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164088
AA Change: P330S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166
AA Change: P330S

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect possibly damaging
Transcript: ENSMUST00000167706
AA Change: P321S

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: P321S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168036
AA Change: P330S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166
AA Change: P330S

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect possibly damaging
Transcript: ENSMUST00000169921
AA Change: P371S

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: P371S

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219544
Meta Mutation Damage Score 0.1595 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,900 H230Q probably benign Het
2510039O18Rik A G 4: 147,941,817 T265A probably benign Het
Adap1 A T 5: 139,293,145 Y127N probably damaging Het
Alg8 T C 7: 97,382,982 F246S probably benign Het
Alpk1 A G 3: 127,724,449 Y68H probably damaging Het
Arhgef5 T C 6: 43,275,032 S906P probably benign Het
C9 A T 15: 6,489,906 D408V probably benign Het
Cpeb4 T A 11: 31,924,700 Y174N probably benign Het
Enpp3 A G 10: 24,807,453 Y289H probably damaging Het
Erbin A T 13: 103,884,210 D80E probably damaging Het
Fgd6 A T 10: 94,074,320 E829V possibly damaging Het
Foxn2 T G 17: 88,486,795 S387A probably benign Het
H2afy2 A G 10: 61,741,267 I274T probably damaging Het
Kif13a A G 13: 46,752,746 S574P possibly damaging Het
Lhx6 T G 2: 36,091,378 D67A probably damaging Het
Lmbr1l A T 15: 98,909,240 M220K probably damaging Het
Lrmp T C 6: 145,160,893 L201S probably damaging Het
Naa35 T C 13: 59,625,564 L111P probably damaging Het
Notch2 T A 3: 98,134,586 V1307E probably damaging Het
Nts T A 10: 102,484,998 M77L probably benign Het
Olfr1029 A C 2: 85,975,434 S64R possibly damaging Het
Pigz A G 16: 31,945,543 N473S probably benign Het
Pkd2 A G 5: 104,480,329 D423G probably damaging Het
Plac8 A G 5: 100,562,619 probably null Het
Ppp2r2b T C 18: 42,688,588 probably null Het
Proc T C 18: 32,123,648 N322S probably benign Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Psd3 A G 8: 68,120,746 probably null Het
Safb A G 17: 56,585,169 probably benign Het
Scnn1g A G 7: 121,742,263 D216G probably benign Het
Sept7 A G 9: 25,303,752 E345G possibly damaging Het
Sult2a5 A T 7: 13,665,058 K197* probably null Het
Suv39h1 C A X: 8,062,899 R397L probably damaging Homo
Thbs4 T A 13: 92,755,166 M814L possibly damaging Het
Tmem14a T A 1: 21,229,581 probably benign Het
Tmprss11d C A 5: 86,309,300 A167S probably damaging Het
Ttn C A 2: 76,798,908 C14362F probably damaging Het
Usp15 T C 10: 123,168,367 I161V possibly damaging Het
Vmn1r67 T C 7: 10,447,211 L134P probably damaging Het
Wdr74 A G 19: 8,736,222 E73G possibly damaging Het
Zbtb49 A T 5: 38,201,058 M617K possibly damaging Het
Zc3h3 G A 15: 75,756,634 T937I probably benign Het
Zeb2 C T 2: 45,110,016 V25M probably null Het
Zfp108 T C 7: 24,261,772 F596S probably damaging Het
Zfyve1 T A 12: 83,594,844 N13Y possibly damaging Het
Zswim2 T C 2: 83,923,761 D185G probably benign Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116507071 missense probably benign 0.02
IGL02433:Cnot2 APN 10 116492336 missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116499357 missense probably benign 0.15
IGL03383:Cnot2 APN 10 116494817 splice site probably benign
R0145:Cnot2 UTSW 10 116517368 missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116498355 missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116498236 missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116498415 missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116527876 missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116506280 missense probably benign 0.01
R4063:Cnot2 UTSW 10 116537396 missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116498143 missense possibly damaging 0.81
R4196:Cnot2 UTSW 10 116501304 missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116581474 unclassified probably benign
R4572:Cnot2 UTSW 10 116494846 missense probably benign 0.37
R4610:Cnot2 UTSW 10 116499418 missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116506310 unclassified probably null
R5847:Cnot2 UTSW 10 116527946 missense probably damaging 0.98
R6444:Cnot2 UTSW 10 116499355 missense probably benign 0.02
R6733:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116537223 intron probably benign
R7139:Cnot2 UTSW 10 116495019 missense probably benign 0.00
R7248:Cnot2 UTSW 10 116498373 missense probably benign 0.05
R7423:Cnot2 UTSW 10 116492398 missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116507080 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ACAAGTCTGAGGCTCTCTGTGG -3'
(R):5'- AAAAGGGGATCCAGGTGTTACC -3'

Sequencing Primer
(F):5'- GGATAACACCTATAATGCCTGCCTG -3'
(R):5'- TGGGACTCCATAAATATGTCAGAG -3'
Posted On2018-08-01