Mutagenetix > Incidental Mutation

Incidental Mutation 'R6735:Kif13a'

530196

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

044853-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R6735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46902563-47083343 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46906222 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 574 (S574P)

Ref Sequence

ENSEMBL: ENSMUSP00000153657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000056978
AA Change: S1522P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: S1522P

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223881
AA Change: S574P

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000225836

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	A	G	4: 148,026,274 (GRCm39)	T265A	probably benign	Het
Adap1	A	T	5: 139,278,900 (GRCm39)	Y127N	probably damaging	Het
Alg8	T	C	7: 97,032,189 (GRCm39)	F246S	probably benign	Het
Alpk1	A	G	3: 127,518,098 (GRCm39)	Y68H	probably damaging	Het
Arhgef5	T	C	6: 43,251,966 (GRCm39)	S906P	probably benign	Het
C9	A	T	15: 6,519,387 (GRCm39)	D408V	probably benign	Het
Cnot2	G	A	10: 116,334,058 (GRCm39)	P371S	possibly damaging	Het
Cpeb4	T	A	11: 31,874,700 (GRCm39)	Y174N	probably benign	Het
Enpp3	A	G	10: 24,683,351 (GRCm39)	Y289H	probably damaging	Het
Erbin	A	T	13: 104,020,718 (GRCm39)	D80E	probably damaging	Het
Fgd6	A	T	10: 93,910,182 (GRCm39)	E829V	possibly damaging	Het
Foxn2	T	G	17: 88,794,223 (GRCm39)	S387A	probably benign	Het
Hapstr1	T	A	16: 8,673,764 (GRCm39)	H230Q	probably benign	Het
Irag2	T	C	6: 145,106,619 (GRCm39)	L201S	probably damaging	Het
Lhx6	T	G	2: 35,981,390 (GRCm39)	D67A	probably damaging	Het
Lmbr1l	A	T	15: 98,807,121 (GRCm39)	M220K	probably damaging	Het
Macroh2a2	A	G	10: 61,577,046 (GRCm39)	I274T	probably damaging	Het
Naa35	T	C	13: 59,773,378 (GRCm39)	L111P	probably damaging	Het
Notch2	T	A	3: 98,041,902 (GRCm39)	V1307E	probably damaging	Het
Nts	T	A	10: 102,320,859 (GRCm39)	M77L	probably benign	Het
Or5m11b	A	C	2: 85,805,778 (GRCm39)	S64R	possibly damaging	Het
Pigz	A	G	16: 31,764,361 (GRCm39)	N473S	probably benign	Het
Pkd2	A	G	5: 104,628,195 (GRCm39)	D423G	probably damaging	Het
Plac8	A	G	5: 100,710,485 (GRCm39)		probably null	Het
Ppp2r2b	T	C	18: 42,821,653 (GRCm39)		probably null	Het
Proc	T	C	18: 32,256,701 (GRCm39)	N322S	probably benign	Het
Prpf40b	C	T	15: 99,212,784 (GRCm39)	R627W	probably damaging	Het
Psd3	A	G	8: 68,573,398 (GRCm39)		probably null	Het
Safb	A	G	17: 56,892,169 (GRCm39)		probably benign	Het
Scnn1g	A	G	7: 121,341,486 (GRCm39)	D216G	probably benign	Het
Septin7	A	G	9: 25,215,048 (GRCm39)	E345G	possibly damaging	Het
Sult2a5	A	T	7: 13,398,983 (GRCm39)	K197*	probably null	Het
Suv39h1	C	A	X: 7,929,138 (GRCm39)	R397L	probably damaging	Homo
Thbs4	T	A	13: 92,891,674 (GRCm39)	M814L	possibly damaging	Het
Tmem14a	T	A	1: 21,299,805 (GRCm39)		probably benign	Het
Tmprss11d	C	A	5: 86,457,159 (GRCm39)	A167S	probably damaging	Het
Ttn	C	A	2: 76,629,252 (GRCm39)	C14362F	probably damaging	Het
Usp15	T	C	10: 123,004,272 (GRCm39)	I161V	possibly damaging	Het
Vmn1r67	T	C	7: 10,181,138 (GRCm39)	L134P	probably damaging	Het
Wdr74	A	G	19: 8,713,586 (GRCm39)	E73G	possibly damaging	Het
Zbtb49	A	T	5: 38,358,402 (GRCm39)	M617K	possibly damaging	Het
Zc3h3	G	A	15: 75,628,483 (GRCm39)	T937I	probably benign	Het
Zeb2	C	T	2: 45,000,028 (GRCm39)	V25M	probably null	Het
Zfp108	T	C	7: 23,961,197 (GRCm39)	F596S	probably damaging	Het
Zfyve1	T	A	12: 83,641,618 (GRCm39)	N13Y	possibly damaging	Het
Zswim2	T	C	2: 83,754,105 (GRCm39)	D185G	probably benign	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46,904,110 (GRCm39)	splice site	probably benign
IGL01433:Kif13a	APN	13	46,926,384 (GRCm39)	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	47,018,313 (GRCm39)	splice site	probably benign
IGL01536:Kif13a	APN	13	46,905,765 (GRCm39)	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	47,018,296 (GRCm39)	missense	probably benign
IGL02020:Kif13a	APN	13	46,947,495 (GRCm39)	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46,925,011 (GRCm39)	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46,978,698 (GRCm39)	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46,938,769 (GRCm39)	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46,938,772 (GRCm39)	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46,926,314 (GRCm39)	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46,905,564 (GRCm39)	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46,918,099 (GRCm39)	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46,939,987 (GRCm39)	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0135:Kif13a	UTSW	13	46,947,419 (GRCm39)	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46,918,079 (GRCm39)	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46,944,827 (GRCm39)	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46,967,695 (GRCm39)	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46,944,877 (GRCm39)	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46,956,187 (GRCm39)	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46,932,364 (GRCm39)	unclassified	probably benign
R0654:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	47,001,813 (GRCm39)	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46,952,689 (GRCm39)	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46,966,299 (GRCm39)	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46,967,712 (GRCm39)	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	47,082,735 (GRCm39)	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46,978,711 (GRCm39)	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46,944,987 (GRCm39)	splice site	probably benign
R1449:Kif13a	UTSW	13	46,966,212 (GRCm39)	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	47,083,088 (GRCm39)	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46,962,689 (GRCm39)	missense	probably benign
R1579:Kif13a	UTSW	13	46,906,332 (GRCm39)	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46,951,885 (GRCm39)	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	possibly damaging	0.50
R1755:Kif13a	UTSW	13	46,906,089 (GRCm39)	missense	possibly damaging	0.73
R1858:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1891:Kif13a	UTSW	13	47,082,695 (GRCm39)	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46,941,638 (GRCm39)	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46,966,221 (GRCm39)	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1961:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R2016:Kif13a	UTSW	13	46,964,275 (GRCm39)	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46,905,945 (GRCm39)	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46,922,652 (GRCm39)	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46,930,573 (GRCm39)	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46,967,676 (GRCm39)	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46,918,072 (GRCm39)	splice site	probably benign
R3499:Kif13a	UTSW	13	46,978,815 (GRCm39)	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46,956,166 (GRCm39)	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46,967,631 (GRCm39)	splice site	probably null
R4771:Kif13a	UTSW	13	46,978,687 (GRCm39)	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46,980,224 (GRCm39)	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	47,083,075 (GRCm39)	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46,962,531 (GRCm39)	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46,906,222 (GRCm39)	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46,930,639 (GRCm39)	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46,941,561 (GRCm39)	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46,956,122 (GRCm39)	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46,906,197 (GRCm39)	missense	probably benign
R5329:Kif13a	UTSW	13	46,928,877 (GRCm39)	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46,926,245 (GRCm39)	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46,986,212 (GRCm39)	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46,905,591 (GRCm39)	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46,906,338 (GRCm39)	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46,978,776 (GRCm39)	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46,925,000 (GRCm39)	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46,954,789 (GRCm39)	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46,980,233 (GRCm39)	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46,968,683 (GRCm39)	splice site	probably null
R6393:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7037:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46,962,632 (GRCm39)	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46,980,221 (GRCm39)	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46,904,089 (GRCm39)	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46,951,955 (GRCm39)	missense	probably benign
R8098:Kif13a	UTSW	13	46,968,780 (GRCm39)	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46,932,444 (GRCm39)	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46,906,057 (GRCm39)	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46,914,813 (GRCm39)	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46,984,279 (GRCm39)	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46,954,921 (GRCm39)	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46,951,841 (GRCm39)	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46,944,941 (GRCm39)	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46,941,536 (GRCm39)	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46,905,934 (GRCm39)	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46,966,263 (GRCm39)	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46,928,909 (GRCm39)	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46,951,838 (GRCm39)	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46,962,472 (GRCm39)	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46,940,099 (GRCm39)	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46,956,020 (GRCm39)	missense	probably benign	0.01
R9749:Kif13a	UTSW	13	46,914,227 (GRCm39)	missense	probably damaging	0.96
X0013:Kif13a	UTSW	13	47,082,746 (GRCm39)	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- ATCCGGTGCAAGTGATGGTC -3'
(R):5'- TCAATCAGACTGTGGCTCTAAGGAG -3'

Sequencing Primer
(F):5'- ACCTCCTTTGTCGAGACGG -3'
(R):5'- GCTAATGGCTGGCTCTGGC -3'

Posted On

2018-08-01