Mutagenetix > Incidental Mutation

Incidental Mutation 'R6735:Thbs4'

530198

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

044853-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92755166 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 814 (M814L)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022213
AA Change: M814L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: M814L

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Meta Mutation Damage Score

0.5240

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.5%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,855,900	H230Q	probably benign	Het
2510039O18Rik	A	G	4: 147,941,817	T265A	probably benign	Het
Adap1	A	T	5: 139,293,145	Y127N	probably damaging	Het
Alg8	T	C	7: 97,382,982	F246S	probably benign	Het
Alpk1	A	G	3: 127,724,449	Y68H	probably damaging	Het
Arhgef5	T	C	6: 43,275,032	S906P	probably benign	Het
C9	A	T	15: 6,489,906	D408V	probably benign	Het
Cnot2	G	A	10: 116,498,153	P371S	possibly damaging	Het
Cpeb4	T	A	11: 31,924,700	Y174N	probably benign	Het
Enpp3	A	G	10: 24,807,453	Y289H	probably damaging	Het
Erbin	A	T	13: 103,884,210	D80E	probably damaging	Het
Fgd6	A	T	10: 94,074,320	E829V	possibly damaging	Het
Foxn2	T	G	17: 88,486,795	S387A	probably benign	Het
H2afy2	A	G	10: 61,741,267	I274T	probably damaging	Het
Kif13a	A	G	13: 46,752,746	S574P	possibly damaging	Het
Lhx6	T	G	2: 36,091,378	D67A	probably damaging	Het
Lmbr1l	A	T	15: 98,909,240	M220K	probably damaging	Het
Lrmp	T	C	6: 145,160,893	L201S	probably damaging	Het
Naa35	T	C	13: 59,625,564	L111P	probably damaging	Het
Notch2	T	A	3: 98,134,586	V1307E	probably damaging	Het
Nts	T	A	10: 102,484,998	M77L	probably benign	Het
Olfr1029	A	C	2: 85,975,434	S64R	possibly damaging	Het
Pigz	A	G	16: 31,945,543	N473S	probably benign	Het
Pkd2	A	G	5: 104,480,329	D423G	probably damaging	Het
Plac8	A	G	5: 100,562,619		probably null	Het
Ppp2r2b	T	C	18: 42,688,588		probably null	Het
Proc	T	C	18: 32,123,648	N322S	probably benign	Het
Prpf40b	C	T	15: 99,314,903	R627W	probably damaging	Het
Psd3	A	G	8: 68,120,746		probably null	Het
Safb	A	G	17: 56,585,169		probably benign	Het
Scnn1g	A	G	7: 121,742,263	D216G	probably benign	Het
Sept7	A	G	9: 25,303,752	E345G	possibly damaging	Het
Sult2a5	A	T	7: 13,665,058	K197*	probably null	Het
Suv39h1	C	A	X: 8,062,899	R397L	probably damaging	Homo
Tmem14a	T	A	1: 21,229,581		probably benign	Het
Tmprss11d	C	A	5: 86,309,300	A167S	probably damaging	Het
Ttn	C	A	2: 76,798,908	C14362F	probably damaging	Het
Usp15	T	C	10: 123,168,367	I161V	possibly damaging	Het
Vmn1r67	T	C	7: 10,447,211	L134P	probably damaging	Het
Wdr74	A	G	19: 8,736,222	E73G	possibly damaging	Het
Zbtb49	A	T	5: 38,201,058	M617K	possibly damaging	Het
Zc3h3	G	A	15: 75,756,634	T937I	probably benign	Het
Zeb2	C	T	2: 45,110,016	V25M	probably null	Het
Zfp108	T	C	7: 24,261,772	F596S	probably damaging	Het
Zfyve1	T	A	12: 83,594,844	N13Y	possibly damaging	Het
Zswim2	T	C	2: 83,923,761	D185G	probably benign	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGCAAGGTTGTCGCTCAAG -3'
(R):5'- ATTCAGTCAGCTGTTAGTGTAGCC -3'

Sequencing Primer
(F):5'- AAGGTTGTCGCTCAAGGCTCC -3'
(R):5'- AGTCAGCTGTTAGTGTAGCCTCTTC -3'

Posted On

2018-08-01