Incidental Mutation 'R6737:Cxcr2'
ID530212
Institutional Source Beutler Lab
Gene Symbol Cxcr2
Ensembl Gene ENSMUSG00000026180
Gene Namechemokine (C-X-C motif) receptor 2
SynonymsCD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74153989-74161246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74158631 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 95 (F95L)
Ref Sequence ENSEMBL: ENSMUSP00000102512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]
Predicted Effect probably benign
Transcript: ENSMUST00000027372
AA Change: F95L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: F95L

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.2e-53 PFAM
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106899
AA Change: F95L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: F95L

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.1e-58 PFAM
low complexity region 346 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Cxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02128:Cxcr2 APN 1 74158994 missense probably benign 0.07
IGL03384:Cxcr2 APN 1 74158791 missense probably damaging 0.98
copperas UTSW 1 74158460 missense probably damaging 0.98
R0780:Cxcr2 UTSW 1 74159175 missense probably damaging 0.97
R1178:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1180:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1448:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1535:Cxcr2 UTSW 1 74159058 missense probably damaging 1.00
R1851:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R1852:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R2897:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R2898:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R4430:Cxcr2 UTSW 1 74158845 missense probably benign 0.01
R4542:Cxcr2 UTSW 1 74158529 missense probably benign 0.02
R5625:Cxcr2 UTSW 1 74158832 nonsense probably null
R5996:Cxcr2 UTSW 1 74158460 missense probably damaging 0.98
R7206:Cxcr2 UTSW 1 74159054 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATGCCCTCTATTCTGCCAGATG -3'
(R):5'- CCAAGTGTCTCTTCTGGATCAG -3'

Sequencing Primer
(F):5'- AGATGCTGTCCCATGCCAC -3'
(R):5'- CAAGTGTCTCTTCTGGATCAGTGTAC -3'
Posted On2018-08-01