Mutagenetix > Incidental Mutations

Incidental Mutation 'R6737:Cecr2'

530233

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6737 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 120737123 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 225 (L225F)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100993
AA Change: L225F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: L225F

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112686
AA Change: L225F

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: L225F

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124634

Predicted Effect

probably benign
Transcript: ENSMUST00000129803
AA Change: L21F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226
AA Change: L21F

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
coiled coil region	90	150	N/A	INTRINSIC
Pfam:Bromodomain	191	234	1.1e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204732

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	T	C	16: 88,707,568	R114G	probably damaging	Het
8430408G22Rik	G	T	6: 116,652,097	V134L	possibly damaging	Het
Atm	A	T	9: 53,486,051	S1661T	probably benign	Het
Cd69	C	T	6: 129,268,299	A188T	probably benign	Het
Cep295	A	G	9: 15,332,351	V1603A	possibly damaging	Het
Clec4g	T	C	8: 3,707,716		probably benign	Het
Clptm1	A	T	7: 19,637,076		probably null	Het
Crybg2	G	T	4: 134,072,690	G387V	probably damaging	Het
Ctcf	T	A	8: 105,664,508	M249K	probably benign	Het
Ctnnd2	C	A	15: 30,966,834	S952*	probably null	Het
Cxcr2	T	C	1: 74,158,631	F95L	probably benign	Het
Ddx55	C	A	5: 124,552,945	T5K	probably damaging	Het
Eif2ak2	T	C	17: 78,863,948	N342S	probably benign	Het
Eif2ak4	TGG	TG	2: 118,462,268		probably null	Het
Epb41l2	C	G	10: 25,489,018		probably null	Het
Fam234b	A	G	6: 135,228,515	K493E	probably damaging	Het
Fndc7	C	A	3: 108,872,278	V317L	probably damaging	Het
Fpr-rs6	T	C	17: 20,183,077	I7M	probably benign	Het
Gal3st1	T	A	11: 3,998,903	I370N	probably benign	Het
Gatsl3	A	G	11: 4,221,685	D303G	probably damaging	Het
Glo1	C	T	17: 30,597,840	S114N	probably benign	Het
Grik1	T	C	16: 88,051,391	D163G	probably damaging	Het
Grxcr1	T	C	5: 68,110,492	C195R	probably damaging	Het
Hdac9	T	C	12: 34,215,452	N806S	probably damaging	Het
Igfn1	T	C	1: 135,969,867	N987S	probably benign	Het
Klhl29	G	T	12: 5,210,124	S31R	possibly damaging	Het
Lama4	C	T	10: 39,094,911	R1491C	probably damaging	Het
Lmtk3	T	C	7: 45,793,627	L578P	probably damaging	Het
Lrrk2	A	C	15: 91,723,218	M595L	possibly damaging	Het
Mmp27	A	T	9: 7,571,954	N52Y	possibly damaging	Het
Mrc1	C	T	2: 14,271,277	A474V	possibly damaging	Het
Msl1	A	G	11: 98,804,082	H134R	probably damaging	Het
Muc5b	T	C	7: 141,857,499	M1394T	unknown	Het
Myof	G	A	19: 37,943,514	T968I	probably benign	Het
Nat8f2	A	T	6: 85,868,212	M56K	probably benign	Het
Ncoa5	C	T	2: 165,002,135	G116D	probably damaging	Het
Ndst2	A	G	14: 20,727,494	L494P	probably damaging	Het
Nfatc3	T	A	8: 106,083,969	V459E	probably damaging	Het
Nup133	A	T	8: 123,906,291	Y1034N	probably damaging	Het
Nup153	A	T	13: 46,689,206	S829T	probably benign	Het
Olfr1317	T	C	2: 112,142,203	F86S	probably damaging	Het
Olfr201	A	G	16: 59,268,812	L285P	possibly damaging	Het
Olfr401	A	G	11: 74,121,906	S206G	probably benign	Het
Olfr628	C	T	7: 103,732,150	L75F	probably damaging	Het
Pcdh18	C	A	3: 49,755,895	V324F	probably damaging	Het
Pcdhb5	T	A	18: 37,322,670	L701H	probably damaging	Het
Plau	T	G	14: 20,837,816	Y43D	probably damaging	Het
Pld5	T	A	1: 176,090,022	N53I	probably damaging	Het
Pon2	T	A	6: 5,266,183	I279F	probably benign	Het
Prep	A	T	10: 45,097,495	K233I	possibly damaging	Het
Rap1b	T	C	10: 117,822,808	Y40C	probably damaging	Het
Ric8a	T	C	7: 140,858,876		probably null	Het
Rnf19b	T	C	4: 129,085,551		probably benign	Het
Rpl9-ps6	A	C	19: 32,466,327	S75R	probably damaging	Het
Sh3bp2	A	G	5: 34,562,474	Y609C	probably damaging	Het
Skint5	T	C	4: 113,535,739	N1232S	unknown	Het
Slc28a1	T	G	7: 81,169,248	V615G	probably benign	Het
Smc1b	C	T	15: 85,092,031	R825Q	probably benign	Het
Snx13	T	G	12: 35,140,186	N845K	probably damaging	Het
Srms	T	C	2: 181,209,460	Y171C	probably damaging	Het
Supt6	A	G	11: 78,231,818	L193P	probably damaging	Het
Syt7	G	A	19: 10,444,044	V531M	probably damaging	Het
Tmem255b	T	C	8: 13,457,096		probably null	Het
Tnik	A	T	3: 28,596,086	K449N	possibly damaging	Het
Trim29	A	T	9: 43,319,384	D288V	probably benign	Het
Ttc13	T	A	8: 124,682,161		probably null	Het
Uchl3	A	T	14: 101,690,597	D167V	probably damaging	Het
Ugt3a1	T	C	15: 9,311,809	V379A	probably benign	Het
Vps13b	A	G	15: 35,910,611	D3507G	probably damaging	Het
Wfdc2	A	T	2: 164,563,442	K88*	probably null	Het
Ylpm1	C	A	12: 85,030,846	H1448Q	probably damaging	Het
Zc3h14	A	G	12: 98,785,046	K667E	probably damaging	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R5970:Cecr2	UTSW	6	120720907	missense	probably damaging	0.98
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	splice site	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAACCTTGATACTTGGCTCTCAGC -3'
(R):5'- ACTGTGGCAGGTGACAGAAC -3'

Sequencing Primer
(F):5'- GTTCTCTGCAGCAAGCCCAC -3'
(R):5'- GTGACAGAACAGAACTAGTTCTCATC -3'

Posted On

2018-08-01