Incidental Mutation 'R6737:Nfatc3'
ID530245
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106083969 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 459 (V459E)
Ref Sequence ENSEMBL: ENSMUSP00000148551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably damaging
Transcript: ENSMUST00000109308
AA Change: V467E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: V467E

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211991
AA Change: V459E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212577
Predicted Effect probably damaging
Transcript: ENSMUST00000212742
AA Change: V459E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212936
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak2 T C 17: 78,863,948 N342S probably benign Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106092195 missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106083854 missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106079645 missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5042:Nfatc3 UTSW 8 106108125 missense probably benign 0.25
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GGCAGAGAGATGCTTTGAGTC -3'
(R):5'- AGAAAGTCAGGAAGGTTTCTTTTGG -3'

Sequencing Primer
(F):5'- CAGAGAGATGCTTTGAGTCTTTGAC -3'
(R):5'- TGGACTAGCTAAGAAAATACTGCC -3'
Posted On2018-08-01