Incidental Mutation 'R6737:Eif2ak2'
ID530280
Institutional Source Beutler Lab
Gene Symbol Eif2ak2
Ensembl Gene ENSMUSG00000024079
Gene Nameeukaryotic translation initiation factor 2-alpha kinase 2
SynonymsdsRNA-activated kinase, eIF-2 alpha, eIF-2 alpha, IFN- type I-induced and dsRNA-activated kinase, IFN-induced and double-stranded RNA-activated kinase, Pkr, Prkr, Tik
MMRRC Submission
Accession Numbers

Genbank: NM_011163; MGI: 1353449

Is this an essential gene? Possibly essential (E-score: 0.627) question?
Stock #R6737 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78852564-78882573 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78863948 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 342 (N342S)
Ref Sequence ENSEMBL: ENSMUSP00000024884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024884]
PDB Structure
Solution structure of the second DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Solution structure of the first DSRM domain in Interferon-induced, double-stranded RNA-activated protein kinase [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000024884
AA Change: N342S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024884
Gene: ENSMUSG00000024079
AA Change: N342S

DomainStartEndE-ValueType
DSRM 9 75 2.34e-20 SMART
DSRM 96 161 7.66e-16 SMART
low complexity region 169 196 N/A INTRINSIC
Pfam:Pkinase 242 500 4.6e-56 PFAM
Pfam:Pkinase_Tyr 242 500 8e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169940
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine protein kinase that is activated by autophosphorylation after binding to dsRNA. The activated form of the encoded protein can phosphorylate translation initiation factor EIF2S1, which in turn inhibits protein synthesis. This protein is also activated by manganese ions and heparin. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display altered susceptibility to viral infection. [provided by MGI curators]
Allele List at MGI

 All alleles(7) : Targeted, knock-out(2) Gene trapped(5)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,568 R114G probably damaging Het
8430408G22Rik G T 6: 116,652,097 V134L possibly damaging Het
Atm A T 9: 53,486,051 S1661T probably benign Het
Cd69 C T 6: 129,268,299 A188T probably benign Het
Cecr2 G T 6: 120,737,123 L225F possibly damaging Het
Cep295 A G 9: 15,332,351 V1603A possibly damaging Het
Clec4g T C 8: 3,707,716 probably benign Het
Clptm1 A T 7: 19,637,076 probably null Het
Crybg2 G T 4: 134,072,690 G387V probably damaging Het
Ctcf T A 8: 105,664,508 M249K probably benign Het
Ctnnd2 C A 15: 30,966,834 S952* probably null Het
Cxcr2 T C 1: 74,158,631 F95L probably benign Het
Ddx55 C A 5: 124,552,945 T5K probably damaging Het
Eif2ak4 TGG TG 2: 118,462,268 probably null Het
Epb41l2 C G 10: 25,489,018 probably null Het
Fam234b A G 6: 135,228,515 K493E probably damaging Het
Fndc7 C A 3: 108,872,278 V317L probably damaging Het
Fpr-rs6 T C 17: 20,183,077 I7M probably benign Het
Gal3st1 T A 11: 3,998,903 I370N probably benign Het
Gatsl3 A G 11: 4,221,685 D303G probably damaging Het
Glo1 C T 17: 30,597,840 S114N probably benign Het
Grik1 T C 16: 88,051,391 D163G probably damaging Het
Grxcr1 T C 5: 68,110,492 C195R probably damaging Het
Hdac9 T C 12: 34,215,452 N806S probably damaging Het
Igfn1 T C 1: 135,969,867 N987S probably benign Het
Klhl29 G T 12: 5,210,124 S31R possibly damaging Het
Lama4 C T 10: 39,094,911 R1491C probably damaging Het
Lmtk3 T C 7: 45,793,627 L578P probably damaging Het
Lrrk2 A C 15: 91,723,218 M595L possibly damaging Het
Mmp27 A T 9: 7,571,954 N52Y possibly damaging Het
Mrc1 C T 2: 14,271,277 A474V possibly damaging Het
Msl1 A G 11: 98,804,082 H134R probably damaging Het
Muc5b T C 7: 141,857,499 M1394T unknown Het
Myof G A 19: 37,943,514 T968I probably benign Het
Nat8f2 A T 6: 85,868,212 M56K probably benign Het
Ncoa5 C T 2: 165,002,135 G116D probably damaging Het
Ndst2 A G 14: 20,727,494 L494P probably damaging Het
Nfatc3 T A 8: 106,083,969 V459E probably damaging Het
Nup133 A T 8: 123,906,291 Y1034N probably damaging Het
Nup153 A T 13: 46,689,206 S829T probably benign Het
Olfr1317 T C 2: 112,142,203 F86S probably damaging Het
Olfr201 A G 16: 59,268,812 L285P possibly damaging Het
Olfr401 A G 11: 74,121,906 S206G probably benign Het
Olfr628 C T 7: 103,732,150 L75F probably damaging Het
Pcdh18 C A 3: 49,755,895 V324F probably damaging Het
Pcdhb5 T A 18: 37,322,670 L701H probably damaging Het
Plau T G 14: 20,837,816 Y43D probably damaging Het
Pld5 T A 1: 176,090,022 N53I probably damaging Het
Pon2 T A 6: 5,266,183 I279F probably benign Het
Prep A T 10: 45,097,495 K233I possibly damaging Het
Rap1b T C 10: 117,822,808 Y40C probably damaging Het
Ric8a T C 7: 140,858,876 probably null Het
Rnf19b T C 4: 129,085,551 probably benign Het
Rpl9-ps6 A C 19: 32,466,327 S75R probably damaging Het
Sh3bp2 A G 5: 34,562,474 Y609C probably damaging Het
Skint5 T C 4: 113,535,739 N1232S unknown Het
Slc28a1 T G 7: 81,169,248 V615G probably benign Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Snx13 T G 12: 35,140,186 N845K probably damaging Het
Srms T C 2: 181,209,460 Y171C probably damaging Het
Supt6 A G 11: 78,231,818 L193P probably damaging Het
Syt7 G A 19: 10,444,044 V531M probably damaging Het
Tmem255b T C 8: 13,457,096 probably null Het
Tnik A T 3: 28,596,086 K449N possibly damaging Het
Trim29 A T 9: 43,319,384 D288V probably benign Het
Ttc13 T A 8: 124,682,161 probably null Het
Uchl3 A T 14: 101,690,597 D167V probably damaging Het
Ugt3a1 T C 15: 9,311,809 V379A probably benign Het
Vps13b A G 15: 35,910,611 D3507G probably damaging Het
Wfdc2 A T 2: 164,563,442 K88* probably null Het
Ylpm1 C A 12: 85,030,846 H1448Q probably damaging Het
Zc3h14 A G 12: 98,785,046 K667E probably damaging Het
Other mutations in Eif2ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Eif2ak2 APN 17 78869483 missense probably benign 0.00
IGL01017:Eif2ak2 APN 17 78863858 missense probably damaging 1.00
IGL01068:Eif2ak2 APN 17 78865371 missense probably damaging 1.00
3-1:Eif2ak2 UTSW 17 78869498 missense probably benign 0.00
R0038:Eif2ak2 UTSW 17 78863955 missense probably benign
R0801:Eif2ak2 UTSW 17 78866349 nonsense probably null
R1702:Eif2ak2 UTSW 17 78856634 missense probably damaging 1.00
R2020:Eif2ak2 UTSW 17 78863963 missense possibly damaging 0.87
R2159:Eif2ak2 UTSW 17 78874018 missense possibly damaging 0.77
R3405:Eif2ak2 UTSW 17 78858639 splice site probably benign
R3406:Eif2ak2 UTSW 17 78858639 splice site probably benign
R4355:Eif2ak2 UTSW 17 78858534 missense probably benign 0.08
R5135:Eif2ak2 UTSW 17 78866345 missense probably damaging 0.96
R5145:Eif2ak2 UTSW 17 78876204 missense possibly damaging 0.60
R5336:Eif2ak2 UTSW 17 78874043 missense probably benign 0.00
R6195:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6233:Eif2ak2 UTSW 17 78871233 nonsense probably null
R6417:Eif2ak2 UTSW 17 78856619 missense probably damaging 1.00
R7108:Eif2ak2 UTSW 17 78858536 nonsense probably null
R7238:Eif2ak2 UTSW 17 78866331 missense probably benign 0.01
R7830:Eif2ak2 UTSW 17 78866403 missense probably damaging 1.00
R7843:Eif2ak2 UTSW 17 78868774 missense probably benign 0.24
R7845:Eif2ak2 UTSW 17 78863898 missense probably damaging 1.00
R8003:Eif2ak2 UTSW 17 78876223 missense probably damaging 0.99
R8143:Eif2ak2 UTSW 17 78858532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TCGTGACTAACTGCCAATCAC -3'
(R):5'- CTGGATGCTTGGGAAATTATGAC -3'

Sequencing Primer
(F):5'- TCGTGACTAACTGCCAATCACAAATC -3'
(R):5'- TCTGAGACATGCTTTGGG -3'
Posted On2018-08-01