Incidental Mutation 'R6738:Il18r1'
ID530285
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40498656 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 527 (E527G)
Ref Sequence ENSEMBL: ENSMUSP00000142070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000195684]
Predicted Effect probably benign
Transcript: ENSMUST00000087983
AA Change: E527G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: E527G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108044
AA Change: E527G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: E527G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195684
AA Change: E527G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: E527G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40495788 missense probably benign 0.00
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R4972:Il18r1 UTSW 1 40491064 missense probably benign 0.39
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6458:Il18r1 UTSW 1 40491182 nonsense probably null
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R7002:Il18r1 UTSW 1 40474853 missense probably benign 0.39
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
R7485:Il18r1 UTSW 1 40480980 missense probably benign 0.01
R7510:Il18r1 UTSW 1 40474875 missense probably benign 0.03
R7515:Il18r1 UTSW 1 40498670 missense not run
R7526:Il18r1 UTSW 1 40471772 missense probably damaging 0.99
R7793:Il18r1 UTSW 1 40471764 missense probably benign 0.01
R7870:Il18r1 UTSW 1 40491136 missense probably benign 0.45
R7953:Il18r1 UTSW 1 40491136 missense probably benign 0.45
R8004:Il18r1 UTSW 1 40474757 missense probably damaging 1.00
R8063:Il18r1 UTSW 1 40487038 missense probably benign 0.10
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 intron probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTCCACGAAGCACTGGTAG -3'
(R):5'- TCATCTGTGATGACCCGATG -3'

Sequencing Primer
(F):5'- CCACGAAGCACTGGTAGAGAGG -3'
(R):5'- TCTGTGATGACCCGATGACAACTC -3'
Posted On2018-08-01