Incidental Mutation 'R6738:Slc23a2'
ID530295
Institutional Source Beutler Lab
Gene Symbol Slc23a2
Ensembl Gene ENSMUSG00000027340
Gene Namesolute carrier family 23 (nucleobase transporters), member 2
SynonymsSlc23a1, SVCT2, YSPL3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132052496-132145108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132078436 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 183 (D183G)
Ref Sequence ENSEMBL: ENSMUSP00000028815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028815]
Predicted Effect probably benign
Transcript: ENSMUST00000028815
AA Change: D183G

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000028815
Gene: ENSMUSG00000027340
AA Change: D183G

DomainStartEndE-ValueType
Pfam:Xan_ur_permease 101 534 1.7e-93 PFAM
transmembrane domain 547 566 N/A INTRINSIC
low complexity region 578 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154009
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The absorption of vitamin C into the body and its distribution to organs requires two sodium-dependent vitamin C transporters. This gene encodes one of the two required transporters and the encoded protein accounts for tissue-specific uptake of vitamin C. Previously, this gene had an official symbol of SLC23A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within minutes of birth from respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Slc23a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc23a2 APN 2 132101500 missense probably benign 0.00
IGL01123:Slc23a2 APN 2 132056816 missense probably benign 0.02
IGL03115:Slc23a2 APN 2 132091265 missense probably damaging 1.00
R0352:Slc23a2 UTSW 2 132060796 missense probably benign 0.03
R0446:Slc23a2 UTSW 2 132078433 missense probably benign 0.06
R0499:Slc23a2 UTSW 2 132072017 missense probably damaging 1.00
R1252:Slc23a2 UTSW 2 132062197 splice site probably null
R1663:Slc23a2 UTSW 2 132065464 missense probably damaging 1.00
R1768:Slc23a2 UTSW 2 132075641 missense probably benign
R1914:Slc23a2 UTSW 2 132056766 missense probably damaging 0.99
R2277:Slc23a2 UTSW 2 132091259 missense possibly damaging 0.54
R2326:Slc23a2 UTSW 2 132094195 missense possibly damaging 0.72
R2385:Slc23a2 UTSW 2 132089201 missense probably benign 0.01
R4049:Slc23a2 UTSW 2 132060683 missense probably benign 0.00
R4084:Slc23a2 UTSW 2 132091217 nonsense probably null
R4497:Slc23a2 UTSW 2 132056782 nonsense probably null
R4710:Slc23a2 UTSW 2 132056709 missense probably benign
R4873:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R4875:Slc23a2 UTSW 2 132056880 missense possibly damaging 0.75
R5008:Slc23a2 UTSW 2 132101494 missense probably damaging 0.99
R5164:Slc23a2 UTSW 2 132075450 intron probably benign
R5236:Slc23a2 UTSW 2 132075584 missense probably damaging 0.97
R6587:Slc23a2 UTSW 2 132078481 missense possibly damaging 0.70
R6960:Slc23a2 UTSW 2 132091253 missense probably damaging 1.00
R7000:Slc23a2 UTSW 2 132094203 missense possibly damaging 0.93
R7062:Slc23a2 UTSW 2 132091269 missense probably damaging 0.99
R7293:Slc23a2 UTSW 2 132089106 missense probably benign 0.02
R7324:Slc23a2 UTSW 2 132089123 missense probably damaging 1.00
X0011:Slc23a2 UTSW 2 132091263 missense possibly damaging 0.64
X0018:Slc23a2 UTSW 2 132066806 missense probably benign 0.30
Z1176:Slc23a2 UTSW 2 132060788 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGACTGGAGCATTCTAAGCTG -3'
(R):5'- ACTAGTGGCTCCAGCTATGTG -3'

Sequencing Primer
(F):5'- GACTGGAGCATTCTAAGCTGCTTAC -3'
(R):5'- CTGTCAGAGGTCTTCACAGAG -3'
Posted On2018-08-01