Incidental Mutation 'R6738:Wdr54'
ID530303
Institutional Source Beutler Lab
Gene Symbol Wdr54
Ensembl Gene ENSMUSG00000030032
Gene NameWD repeat domain 54
Synonyms1700030E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location83149361-83156397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83155127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 99 (S99P)
Ref Sequence ENSEMBL: ENSMUSP00000122873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032106] [ENSMUST00000065512] [ENSMUST00000087938] [ENSMUST00000121093] [ENSMUST00000125894] [ENSMUST00000153148] [ENSMUST00000203203]
Predicted Effect probably benign
Transcript: ENSMUST00000032106
SMART Domains Protein: ENSMUSP00000032106
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 571 3.7e-266 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000032108
Predicted Effect probably benign
Transcript: ENSMUST00000065512
SMART Domains Protein: ENSMUSP00000065571
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 36 99 5.65e-13 SMART
Pfam:Anillin 117 270 8.3e-46 PFAM
PH 310 418 2.3e-4 SMART
low complexity region 490 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087938
SMART Domains Protein: ENSMUSP00000085249
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121093
SMART Domains Protein: ENSMUSP00000112501
Gene: ENSMUSG00000034930

DomainStartEndE-ValueType
Hr1 23 86 1.62e-13 SMART
Pfam:Anillin 103 258 8e-25 PFAM
PH 297 405 2.3e-4 SMART
low complexity region 477 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125894
AA Change: S99P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122873
Gene: ENSMUSG00000030032
AA Change: S99P

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146969
Predicted Effect probably benign
Transcript: ENSMUST00000153148
AA Change: S99P

PolyPhen 2 Score 0.108 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116608
Gene: ENSMUSG00000030032
AA Change: S99P

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
WD40 153 197 5.92e1 SMART
WD40 201 238 3.55e1 SMART
WD40 241 280 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203183
Predicted Effect probably benign
Transcript: ENSMUST00000203203
SMART Domains Protein: ENSMUSP00000145406
Gene: ENSMUSG00000030030

DomainStartEndE-ValueType
Pfam:DUF4639 6 82 1.4e-52 PFAM
low complexity region 90 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213056
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Wdr54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Wdr54 APN 6 83155773 missense probably benign 0.00
IGL02537:Wdr54 APN 6 83153391 missense possibly damaging 0.94
R6562:Wdr54 UTSW 6 83155068 critical splice donor site probably null
R6820:Wdr54 UTSW 6 83154619 missense probably benign 0.00
R6990:Wdr54 UTSW 6 83155647 critical splice donor site probably null
R7343:Wdr54 UTSW 6 83154939 missense probably benign 0.00
R7610:Wdr54 UTSW 6 83152858 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AATTCCTCGGGCAAACATAGC -3'
(R):5'- TTTTAGATGTCACATGCGCAG -3'

Sequencing Primer
(F):5'- TAGCCTGTACTGAATACAAAAGCAG -3'
(R):5'- ATTAACTCTGTGACCCTTGGG -3'
Posted On2018-08-01