Incidental Mutation 'R6738:C1ra'
ID530304
Institutional Source Beutler Lab
Gene Symbol C1ra
Ensembl Gene ENSMUSG00000055172
Gene Namecomplement component 1, r subcomponent A
SynonymsmC1rA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6738 (G1)
Quality Score223.009
Status Validated
Chromosome6
Chromosomal Location124512405-124523443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124517759 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 327 (Y327C)
Ref Sequence ENSEMBL: ENSMUSP00000063707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068593]
Predicted Effect probably damaging
Transcript: ENSMUST00000068593
AA Change: Y327C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063707
Gene: ENSMUSG00000055172
AA Change: Y327C

DomainStartEndE-ValueType
CUB 14 140 1.56e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 5.56e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 699 2.7e-71 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in C1ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:C1ra APN 6 124522291 missense probably benign 0.00
IGL03079:C1ra APN 6 124519835 missense probably damaging 1.00
IGL03151:C1ra APN 6 124519771 missense probably benign 0.09
mueller-eberhardt UTSW 6 124512801 critical splice donor site probably null
pillemer UTSW 6 124516724 missense probably damaging 1.00
R0331:C1ra UTSW 6 124519435 splice site probably null
R0457:C1ra UTSW 6 124522753 missense probably benign
R0472:C1ra UTSW 6 124517444 missense possibly damaging 0.95
R0570:C1ra UTSW 6 124513705 missense probably benign 0.00
R0634:C1ra UTSW 6 124517505 missense possibly damaging 0.49
R0661:C1ra UTSW 6 124522377 missense probably benign
R1451:C1ra UTSW 6 124521641 missense probably benign 0.04
R1640:C1ra UTSW 6 124522274 missense probably benign 0.17
R1698:C1ra UTSW 6 124522766 missense probably benign 0.05
R4020:C1ra UTSW 6 124519777 missense probably benign 0.01
R4801:C1ra UTSW 6 124513768 missense probably benign 0.00
R4802:C1ra UTSW 6 124513768 missense probably benign 0.00
R4909:C1ra UTSW 6 124522334 missense probably damaging 1.00
R5086:C1ra UTSW 6 124519729 missense probably damaging 1.00
R5108:C1ra UTSW 6 124522922 missense probably damaging 1.00
R5372:C1ra UTSW 6 124521625 missense probably damaging 1.00
R5421:C1ra UTSW 6 124522790 missense probably benign 0.36
R5635:C1ra UTSW 6 124516724 missense probably damaging 1.00
R6438:C1ra UTSW 6 124513777 missense possibly damaging 0.54
R6518:C1ra UTSW 6 124521575 intron probably null
R6804:C1ra UTSW 6 124517725 missense probably benign
R6805:C1ra UTSW 6 124517725 missense probably benign
R6939:C1ra UTSW 6 124512801 critical splice donor site probably null
R6981:C1ra UTSW 6 124517725 missense probably benign
R6982:C1ra UTSW 6 124517725 missense probably benign
R7056:C1ra UTSW 6 124517725 missense probably benign
R7057:C1ra UTSW 6 124517725 missense probably benign
R7094:C1ra UTSW 6 124517725 missense probably benign
R7468:C1ra UTSW 6 124522444 nonsense probably null
R7476:C1ra UTSW 6 124522699 missense probably damaging 1.00
R7478:C1ra UTSW 6 124517725 missense probably benign
R7479:C1ra UTSW 6 124517725 missense probably benign
R7481:C1ra UTSW 6 124517725 missense probably benign
R7512:C1ra UTSW 6 124517725 missense probably benign
R7725:C1ra UTSW 6 124517725 missense probably benign
R7728:C1ra UTSW 6 124517725 missense probably benign
R7730:C1ra UTSW 6 124517725 missense probably benign
R7818:C1ra UTSW 6 124517725 missense probably benign
R7819:C1ra UTSW 6 124517725 missense probably benign
R7835:C1ra UTSW 6 124517725 missense probably benign
R7854:C1ra UTSW 6 124517741 missense probably benign 0.00
R7876:C1ra UTSW 6 124517725 missense probably benign
R7877:C1ra UTSW 6 124517725 missense probably benign
R7881:C1ra UTSW 6 124517725 missense probably benign
R7883:C1ra UTSW 6 124517725 missense probably benign
R7892:C1ra UTSW 6 124519415 missense probably benign 0.07
R7899:C1ra UTSW 6 124517725 missense probably benign
R7901:C1ra UTSW 6 124517725 missense probably benign
R7902:C1ra UTSW 6 124517725 missense probably benign
R7903:C1ra UTSW 6 124517725 missense probably benign
R7937:C1ra UTSW 6 124517741 missense probably benign 0.00
R7975:C1ra UTSW 6 124519415 missense probably benign 0.07
R8087:C1ra UTSW 6 124513872 missense probably damaging 1.00
R8098:C1ra UTSW 6 124517725 missense probably benign
R8099:C1ra UTSW 6 124517725 missense probably benign
X0062:C1ra UTSW 6 124522439 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTCCTGGGAAACTTGTG -3'
(R):5'- TCTGAGGGCAGACAGATTGATTC -3'

Sequencing Primer
(F):5'- ACTTGTGTTGAACATGGATGAGACC -3'
(R):5'- GGCAGACAGATTGATTCTTCCAGC -3'
Posted On2018-08-01