Incidental Mutation 'R6738:Prkd2'
ID530305
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Nameprotein kinase D2
SynonymsPKD2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16842902-16870464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 16865905 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 764 (N764K)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086104] [ENSMUST00000168093]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086104
AA Change: N764K

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: N764K

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168093
AA Change: N764K

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: N764K

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206510
Meta Mutation Damage Score 0.4238 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16865862 missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16848811 missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16863942 missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16869576 splice site probably null
IGL01969:Prkd2 APN 7 16865757 missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16857832 missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16855890 missense probably benign 0.04
IGL02834:Prkd2 APN 7 16845934 missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16869832 missense probably benign 0.01
IGL03053:Prkd2 APN 7 16850263 missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16850263 missense possibly damaging 0.63
alila UTSW 7 16847654 missense probably damaging 1.00
Beaches UTSW 7 16849203 nonsense probably null
Purnama UTSW 7 16869565 missense probably damaging 1.00
Sandals UTSW 7 16865714 missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16847643 missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16849044 missense probably benign
R0190:Prkd2 UTSW 7 16869890 missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16865677 splice site probably benign
R1418:Prkd2 UTSW 7 16869545 missense probably benign 0.03
R1488:Prkd2 UTSW 7 16858439 missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16857807 missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16847677 nonsense probably null
R2042:Prkd2 UTSW 7 16856268 missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16869565 missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16853255 missense probably benign 0.02
R4601:Prkd2 UTSW 7 16843648 unclassified probably benign
R4979:Prkd2 UTSW 7 16848727 missense probably damaging 1.00
R5240:Prkd2 UTSW 7 16855786 missense probably benign 0.09
R5643:Prkd2 UTSW 7 16843792 missense probably benign 0.02
R5994:Prkd2 UTSW 7 16850336 missense probably benign 0.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6361:Prkd2 UTSW 7 16847654 missense probably damaging 1.00
R6798:Prkd2 UTSW 7 16849203 nonsense probably null
R6815:Prkd2 UTSW 7 16843793 missense probably benign 0.00
R7241:Prkd2 UTSW 7 16857805 missense probably benign 0.44
R7293:Prkd2 UTSW 7 16845940 missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16847622 missense probably benign 0.07
R7900:Prkd2 UTSW 7 16853344 missense probably benign 0.01
R7983:Prkd2 UTSW 7 16853344 missense probably benign 0.01
X0062:Prkd2 UTSW 7 16855791 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGCTCTGTGACTTTGGCTTC -3'
(R):5'- CCTTACAGCCTCACCTACTAGG -3'

Sequencing Primer
(F):5'- ATCATCGGCGAGAAGTCCTTC -3'
(R):5'- GTCCCCACACTTACTAATCC -3'
Posted On2018-08-01