Incidental Mutation 'R6738:Ric3'
ID530307
Institutional Source Beutler Lab
Gene Symbol Ric3
Ensembl Gene ENSMUSG00000048330
Gene NameRIC3 acetylcholine receptor chaperone
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location109034312-109083331 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 109048062 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 184 (R184*)
Ref Sequence ENSEMBL: ENSMUSP00000112788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055993] [ENSMUST00000120876] [ENSMUST00000147580]
Predicted Effect probably null
Transcript: ENSMUST00000055993
AA Change: R185*
SMART Domains Protein: ENSMUSP00000056990
Gene: ENSMUSG00000048330
AA Change: R185*

DomainStartEndE-ValueType
Pfam:RIC3 15 165 1.2e-38 PFAM
low complexity region 256 272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120876
AA Change: R184*
SMART Domains Protein: ENSMUSP00000112788
Gene: ENSMUSG00000048330
AA Change: R184*

DomainStartEndE-ValueType
Pfam:RIC3 15 165 3.9e-52 PFAM
low complexity region 255 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133876
Predicted Effect probably benign
Transcript: ENSMUST00000147580
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the resistance to inhibitors of cholinesterase 3-like family which functions as a chaperone of specific 5-hydroxytryptamine type 3 receptor and nicotinic acetylcholine receptor subtypes. The encoded protein influences the folding and assembly of these receptor subunits in the endoplasmic reticulum and expression on the cell surface. This protein contains an N-terminal transmembrane domain, a proline-rich spacer, and a cytosolic C-terminal coiled-coil domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Ric3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ric3 APN 7 109054412 missense probably damaging 1.00
IGL00942:Ric3 APN 7 109054413 missense probably damaging 1.00
IGL02318:Ric3 APN 7 109048080 missense probably damaging 1.00
IGL02868:Ric3 APN 7 109054419 missense probably damaging 1.00
IGL03012:Ric3 APN 7 109038718 missense probably benign
R0842:Ric3 UTSW 7 109038880 missense probably damaging 1.00
R2291:Ric3 UTSW 7 109038883 missense probably damaging 1.00
R2912:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R2913:Ric3 UTSW 7 109054453 missense possibly damaging 0.87
R3690:Ric3 UTSW 7 109038610 missense possibly damaging 0.89
R4587:Ric3 UTSW 7 109054363 critical splice donor site probably null
R5039:Ric3 UTSW 7 109038723 missense probably benign
R5636:Ric3 UTSW 7 109038820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGAAATTGCCCTATTCTGACAC -3'
(R):5'- GAACTAACATCTCTGGCTACAGC -3'

Sequencing Primer
(F):5'- GATTATCACCGTACATTTGCCAAAC -3'
(R):5'- CCATGACATCCAGAAATCACCTGTTG -3'
Posted On2018-08-01