Incidental Mutation 'R6738:Esyt3'
ID530312
Institutional Source Beutler Lab
Gene Symbol Esyt3
Ensembl Gene ENSMUSG00000037681
Gene Nameextended synaptotagmin-like protein 3
SynonymsFam62c, D9Ertd280e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99309963-99358557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 99320293 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 522 (F522I)
Ref Sequence ENSEMBL: ENSMUSP00000038757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042158] [ENSMUST00000187520]
Predicted Effect probably damaging
Transcript: ENSMUST00000042158
AA Change: F522I

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038757
Gene: ENSMUSG00000037681
AA Change: F522I

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
Pfam:SMP_LBD 118 295 3.7e-63 PFAM
C2 311 411 9.23e-20 SMART
low complexity region 422 432 N/A INTRINSIC
C2 449 563 6.6e-7 SMART
low complexity region 658 673 N/A INTRINSIC
low complexity region 729 739 N/A INTRINSIC
C2 775 880 4.91e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186626
Predicted Effect possibly damaging
Transcript: ENSMUST00000187520
AA Change: F173I

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140567
Gene: ENSMUSG00000037681
AA Change: F173I

DomainStartEndE-ValueType
C2 2 83 5.9e-12 SMART
low complexity region 94 104 N/A INTRINSIC
C2 121 198 2.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191694
Meta Mutation Damage Score 0.2608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Esyt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02576:Esyt3 APN 9 99315225 missense probably benign 0.07
IGL02596:Esyt3 APN 9 99328015 missense probably benign 0.02
IGL02716:Esyt3 APN 9 99317224 missense probably damaging 1.00
IGL02836:Esyt3 APN 9 99320907 splice site probably benign
IGL03372:Esyt3 APN 9 99336056 splice site probably benign
R0008:Esyt3 UTSW 9 99338807 missense possibly damaging 0.89
R1217:Esyt3 UTSW 9 99318044 missense possibly damaging 0.92
R1395:Esyt3 UTSW 9 99316782 unclassified probably benign
R1478:Esyt3 UTSW 9 99318066 missense probably benign 0.03
R1710:Esyt3 UTSW 9 99336191 missense probably benign
R1792:Esyt3 UTSW 9 99358116 nonsense probably null
R1913:Esyt3 UTSW 9 99320311 missense probably benign 0.00
R3792:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3793:Esyt3 UTSW 9 99315281 missense possibly damaging 0.93
R3937:Esyt3 UTSW 9 99336192 missense probably benign
R3964:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R3965:Esyt3 UTSW 9 99320322 missense probably damaging 1.00
R4061:Esyt3 UTSW 9 99320838 missense probably damaging 1.00
R4088:Esyt3 UTSW 9 99324237 missense probably benign
R4436:Esyt3 UTSW 9 99358025 intron probably benign
R5274:Esyt3 UTSW 9 99318297 missense probably benign
R5590:Esyt3 UTSW 9 99358413 utr 5 prime probably benign
R5705:Esyt3 UTSW 9 99318207 missense probably benign 0.00
R6543:Esyt3 UTSW 9 99338772 missense possibly damaging 0.77
R7000:Esyt3 UTSW 9 99322153 missense probably damaging 0.99
R7019:Esyt3 UTSW 9 99315285 missense probably benign 0.11
R7104:Esyt3 UTSW 9 99338787 missense probably damaging 1.00
R7130:Esyt3 UTSW 9 99318170 missense probably benign
R7141:Esyt3 UTSW 9 99321440 missense probably benign 0.12
R7145:Esyt3 UTSW 9 99319574 missense probably damaging 1.00
R7447:Esyt3 UTSW 9 99321562 missense probably damaging 1.00
R7459:Esyt3 UTSW 9 99358064 missense probably benign 0.00
R7767:Esyt3 UTSW 9 99324971 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCATAGTCTCCTGTGTGGTG -3'
(R):5'- CACCAACAGAATTAGGGCTTAC -3'

Sequencing Primer
(F):5'- ACCAGCCTCAAGGGACTGAG -3'
(R):5'- TACCTTGGAGCACGGTCTGAAG -3'
Posted On2018-08-01