Incidental Mutation 'R6738:Slc22a16'
ID530316
Institutional Source Beutler Lab
Gene Symbol Slc22a16
Ensembl Gene ENSMUSG00000019834
Gene Namesolute carrier family 22 (organic cation transporter), member 16
SynonymsOKB1, FLIPT2, OCT6, CT2, 4921504E14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40570336-40604132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40585302 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 367 (F367L)
Ref Sequence ENSEMBL: ENSMUSP00000077428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019978] [ENSMUST00000078314]
Predicted Effect probably damaging
Transcript: ENSMUST00000019978
AA Change: F388L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000019978
Gene: ENSMUSG00000019834
AA Change: F388L

DomainStartEndE-ValueType
low complexity region 18 32 N/A INTRINSIC
transmembrane domain 38 60 N/A INTRINSIC
Pfam:Sugar_tr 136 556 6.4e-25 PFAM
Pfam:MFS_1 177 514 3.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078314
AA Change: F367L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077428
Gene: ENSMUSG00000019834
AA Change: F367L

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Sugar_tr 114 535 5.1e-26 PFAM
Pfam:MFS_1 156 493 4.7e-20 PFAM
Meta Mutation Damage Score 0.6265 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the organic zwitterion transporter protein family which transports carnitine. The encoded protein has also been shown to transport anticancer drugs like bleomycin (PMID: 20037140) successful treatment has been correlated with the level of activity of this transporter in tumor cells. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Slc22a16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Slc22a16 APN 10 40595282 missense probably damaging 1.00
IGL00334:Slc22a16 APN 10 40573934 missense probably benign 0.03
IGL00757:Slc22a16 APN 10 40581327 missense probably damaging 1.00
IGL01082:Slc22a16 APN 10 40573864 missense probably benign 0.40
IGL01337:Slc22a16 APN 10 40595314 missense possibly damaging 0.51
IGL01389:Slc22a16 APN 10 40585135 missense probably damaging 1.00
IGL01405:Slc22a16 APN 10 40585195 missense probably benign 0.36
IGL01667:Slc22a16 APN 10 40585018 missense probably damaging 1.00
IGL01700:Slc22a16 APN 10 40603908 missense unknown
IGL01792:Slc22a16 APN 10 40573932 missense possibly damaging 0.51
IGL02948:Slc22a16 APN 10 40573962 nonsense probably null
IGL03178:Slc22a16 APN 10 40573760 missense probably benign 0.09
PIT4418001:Slc22a16 UTSW 10 40603825 missense unknown
R0358:Slc22a16 UTSW 10 40587492 splice site probably null
R0422:Slc22a16 UTSW 10 40591890 missense probably damaging 1.00
R0497:Slc22a16 UTSW 10 40584967 missense probably damaging 1.00
R1435:Slc22a16 UTSW 10 40587607 missense probably damaging 1.00
R1577:Slc22a16 UTSW 10 40603815 nonsense probably null
R1696:Slc22a16 UTSW 10 40584927 missense possibly damaging 0.75
R2022:Slc22a16 UTSW 10 40591877 missense probably damaging 1.00
R2065:Slc22a16 UTSW 10 40585020 missense possibly damaging 0.63
R2082:Slc22a16 UTSW 10 40585339 missense probably benign 0.02
R4083:Slc22a16 UTSW 10 40574069 missense probably damaging 1.00
R4588:Slc22a16 UTSW 10 40570681 intron probably benign
R4828:Slc22a16 UTSW 10 40573640 missense probably damaging 1.00
R4853:Slc22a16 UTSW 10 40574051 missense probably damaging 0.98
R5127:Slc22a16 UTSW 10 40573957 missense probably benign 0.21
R5215:Slc22a16 UTSW 10 40581390 missense probably damaging 1.00
R5590:Slc22a16 UTSW 10 40581341 missense possibly damaging 0.94
R5626:Slc22a16 UTSW 10 40584853 critical splice acceptor site probably null
R5810:Slc22a16 UTSW 10 40595318 missense possibly damaging 0.86
R6675:Slc22a16 UTSW 10 40573840 nonsense probably null
R6692:Slc22a16 UTSW 10 40603905 missense unknown
R7158:Slc22a16 UTSW 10 40573741 missense possibly damaging 0.66
R7685:Slc22a16 UTSW 10 40574089 missense possibly damaging 0.73
R7883:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
R7966:Slc22a16 UTSW 10 40603664 missense probably benign 0.01
RF004:Slc22a16 UTSW 10 40603646 missense possibly damaging 0.94
Z1177:Slc22a16 UTSW 10 40585156 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGACTCCCTTTTGGCTC -3'
(R):5'- ACCAATGTTGTTCCCAGCTTAAAG -3'

Sequencing Primer
(F):5'- TTGGCTCCTCTCAGAAGGAAGATAC -3'
(R):5'- GTTGTTCCCAGCTTAAAGATAATGAG -3'
Posted On2018-08-01