Incidental Mutation 'R6738:Gabrb2'
ID530320
Institutional Source Beutler Lab
Gene Symbol Gabrb2
Ensembl Gene ENSMUSG00000007653
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 2
SynonymsC030002O17Rik, C030021G16Rik, Gabrb-2
MMRRC Submission
Accession Numbers

Genbank: NM_008070

Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location42419757-42629028 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42593931 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 272 (A272S)
Ref Sequence ENSEMBL: ENSMUSP00000141868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007797
AA Change: A272S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: A272S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 8.7e-52 PFAM
Pfam:Neur_chan_memb 249 469 7.5e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000192403
AA Change: A272S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: A272S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 36 242 1.1e-54 PFAM
Pfam:Neur_chan_memb 249 507 6.6e-55 PFAM
Meta Mutation Damage Score 0.1989 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Gabrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02275:Gabrb2 APN 11 42591894 missense probably benign 0.00
IGL02666:Gabrb2 APN 11 42529495 critical splice donor site probably null
IGL02983:Gabrb2 APN 11 42421400 missense probably benign 0.00
IGL03357:Gabrb2 APN 11 42591944 missense probably damaging 1.00
H2330:Gabrb2 UTSW 11 42421431 splice site probably benign
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0049:Gabrb2 UTSW 11 42593847 missense probably damaging 1.00
R0100:Gabrb2 UTSW 11 42487314 missense probably damaging 1.00
R1423:Gabrb2 UTSW 11 42529471 missense probably damaging 1.00
R1526:Gabrb2 UTSW 11 42591888 missense possibly damaging 0.83
R1856:Gabrb2 UTSW 11 42626713 missense probably benign 0.01
R1898:Gabrb2 UTSW 11 42593832 missense possibly damaging 0.51
R2184:Gabrb2 UTSW 11 42421428 critical splice donor site probably null
R2371:Gabrb2 UTSW 11 42591864 missense probably damaging 1.00
R2915:Gabrb2 UTSW 11 42591907 missense probably benign
R2993:Gabrb2 UTSW 11 42597649 missense probably damaging 0.99
R3951:Gabrb2 UTSW 11 42626881 missense probably damaging 1.00
R4167:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4168:Gabrb2 UTSW 11 42421328 unclassified probably benign
R4497:Gabrb2 UTSW 11 42597694 missense probably benign 0.05
R4572:Gabrb2 UTSW 11 42593917 missense possibly damaging 0.46
R4784:Gabrb2 UTSW 11 42597642 missense probably damaging 1.00
R4792:Gabrb2 UTSW 11 42529503 splice site probably benign
R5345:Gabrb2 UTSW 11 42626809 missense possibly damaging 0.54
R5346:Gabrb2 UTSW 11 42421389 missense probably benign
R5575:Gabrb2 UTSW 11 42529538 intron probably benign
R5701:Gabrb2 UTSW 11 42487374 missense probably damaging 1.00
R5801:Gabrb2 UTSW 11 42421389 missense probably benign 0.00
R5965:Gabrb2 UTSW 11 42626869 missense probably damaging 1.00
R6930:Gabrb2 UTSW 11 42597613 missense probably damaging 1.00
R7011:Gabrb2 UTSW 11 42626661 missense possibly damaging 0.76
R7045:Gabrb2 UTSW 11 42593931 missense probably damaging 1.00
R7615:Gabrb2 UTSW 11 42626742 missense probably benign 0.06
R7653:Gabrb2 UTSW 11 42487212 missense probably damaging 1.00
R7866:Gabrb2 UTSW 11 42487223 nonsense probably null
R8094:Gabrb2 UTSW 11 42597543 missense probably damaging 0.98
R8402:Gabrb2 UTSW 11 42487304 missense probably damaging 1.00
R8488:Gabrb2 UTSW 11 42626664 missense possibly damaging 0.85
RF008:Gabrb2 UTSW 11 42626878 missense probably damaging 1.00
X0020:Gabrb2 UTSW 11 42422646 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TAAAACACCTGGGATCTCAGAC -3'
(R):5'- ACCGCAAAATTCTGTGTGAGG -3'

Sequencing Primer
(F):5'- CACCTGGGATCTCAGACTATATTTAC -3'
(R):5'- CCGCAAAATTCTGTGTGAGGAAAGG -3'
Posted On2018-08-01