Mutagenetix > Incidental Mutations

Incidental Mutation 'R6738:Gabrb2'

530320

Institutional Source

Beutler Lab

Gene Symbol

Gabrb2

Ensembl Gene

ENSMUSG00000007653

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit beta 2

Synonyms

C030002O17Rik, C030021G16Rik, Gabrb-2

MMRRC Submission

Accession Numbers

Genbank: NM_008070

Is this an essential gene?

Possibly non essential (E-score: 0.388) question?

Stock #

R6738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42419757-42629028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 42593931 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 272 (A272S)

Ref Sequence

ENSEMBL: ENSMUSP00000141868 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007797] [ENSMUST00000192403]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000007797
AA Change: A272S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000007797
Gene: ENSMUSG00000007653
AA Change: A272S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	8.7e-52	PFAM
Pfam:Neur_chan_memb	249	469	7.5e-49	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192403
AA Change: A272S

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000141868
Gene: ENSMUSG00000007653
AA Change: A272S

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:Neur_chan_LBD	36	242	1.1e-54	PFAM
Pfam:Neur_chan_memb	249	507	6.6e-55	PFAM

Meta Mutation Damage Score

0.1989

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 2 subunit. It is mapped to chromosome 5q34 in a cluster comprised of genes encoding alpha 1 and gamma 2 subunits of the GABA A receptor. Alternative splicing of this gene generates 2 transcript variants, differing by a 114 bp insertion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show hyperactivity and abnormal GABA-mediated receptor currents. Homozygotes for a derivative of this allele show a sexually dimorphic cochlear phenotype associated with OHC dysfunction. Homozygotes for a knock-in allele show altered behavioral response to etomidate. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	G	A	1: 93,159,985	L49F	probably benign	Het
Abat	C	T	16: 8,602,436		probably benign	Het
Abl1	T	C	2: 31,794,574	Y454H	probably damaging	Het
Ambp	A	T	4: 63,149,474	D166E	probably benign	Het
Amigo2	A	G	15: 97,245,464	V359A	possibly damaging	Het
Ankrd11	A	T	8: 122,891,921	S1710T	probably damaging	Het
Ankrd31	T	C	13: 96,904,127	S1713P	possibly damaging	Het
Arhgap45	A	T	10: 80,027,597	K758M	probably damaging	Het
Bclaf1	T	C	10: 20,323,769	I304T	possibly damaging	Het
C1ra	A	G	6: 124,517,759	Y327C	probably damaging	Het
Ccdc73	C	T	2: 104,992,088	S794L	probably benign	Het
Cd24a	A	G	10: 43,582,676	N48D	possibly damaging	Het
Col11a1	A	G	3: 114,112,467		probably benign	Het
Cyp11b2	G	A	15: 74,853,514	T252I	possibly damaging	Het
Dlx2	A	G	2: 71,546,062	Y111H	probably benign	Het
Dsp	T	C	13: 38,192,210	S1324P	possibly damaging	Het
Esyt3	A	T	9: 99,320,293	F522I	probably damaging	Het
Fam193b	C	T	13: 55,550,361	A45T	probably benign	Het
Flnb	A	G	14: 7,904,536	T980A	probably benign	Het
H2al2a	G	T	2: 17,996,618	Q86K	possibly damaging	Het
Ikbkb	T	G	8: 22,675,036	I243L	probably damaging	Het
Il18r1	A	G	1: 40,498,656	E527G	probably benign	Het
Krt35	A	T	11: 100,093,709	V320D	probably damaging	Het
Krt76	C	T	15: 101,887,478	R419H	probably benign	Het
Lrp2	T	A	2: 69,458,488	Y3678F	probably damaging	Het
Mnat1	T	G	12: 73,272,472	S290A	probably benign	Het
Mptx2	T	C	1: 173,274,855	E89G	probably benign	Het
Myom1	T	A	17: 71,100,398		probably null	Het
Naaladl2	A	G	3: 24,171,642	V541A	probably benign	Het
Nbeal2	T	C	9: 110,636,905	T851A	possibly damaging	Het
Ncoa4	A	G	14: 32,170,793	Y11C	probably benign	Het
Ntn5	T	A	7: 45,694,356		probably null	Het
Olfr347	C	T	2: 36,734,432	T37I	probably benign	Het
Olfr961	A	G	9: 39,646,661		probably benign	Het
Otop2	A	G	11: 115,329,492	Y386C	probably damaging	Het
Ppp2r1a	T	A	17: 20,954,717		probably null	Het
Prkd2	C	A	7: 16,865,905	N764K	possibly damaging	Het
Ralgapa1	A	G	12: 55,762,727	L421S	probably damaging	Het
Ric3	G	A	7: 109,048,062	R184*	probably null	Het
Sfswap	A	G	5: 129,541,441	K480E	probably damaging	Het
Siah2	A	G	3: 58,691,553	V88A	probably benign	Het
Slc22a16	T	C	10: 40,585,302	F367L	probably damaging	Het
Slc23a2	T	C	2: 132,078,436	D183G	probably benign	Het
Svep1	T	C	4: 58,123,180	N712S	possibly damaging	Het
Tex21	A	G	12: 76,239,509	V72A	probably benign	Het
Tfap4	A	G	16: 4,549,447	Y184H	probably damaging	Het
Timeless	T	C	10: 128,240,635	Y138H	probably damaging	Het
Tln2	A	T	9: 67,386,664	N227K	possibly damaging	Het
Trip10	C	T	17: 57,256,899	P342S	probably benign	Het
Ttc6	A	T	12: 57,688,640	E1156V	probably damaging	Het
Ttn	T	C	2: 76,898,128		probably benign	Het
Vmn2r109	G	A	17: 20,554,523	S190L	possibly damaging	Het
Wdr54	A	G	6: 83,155,127	S99P	probably damaging	Het
Ythdf2	A	C	4: 132,204,961	I296R	probably benign	Het
Zfp445	A	G	9: 122,862,058	V24A	probably damaging	Het

Other mutations in Gabrb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02275:Gabrb2	APN	11	42591894	missense	probably benign	0.00
IGL02666:Gabrb2	APN	11	42529495	critical splice donor site	probably null
IGL02983:Gabrb2	APN	11	42421400	missense	probably benign	0.00
IGL03357:Gabrb2	APN	11	42591944	missense	probably damaging	1.00
H2330:Gabrb2	UTSW	11	42421431	splice site	probably benign
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0049:Gabrb2	UTSW	11	42593847	missense	probably damaging	1.00
R0100:Gabrb2	UTSW	11	42487314	missense	probably damaging	1.00
R1423:Gabrb2	UTSW	11	42529471	missense	probably damaging	1.00
R1526:Gabrb2	UTSW	11	42591888	missense	possibly damaging	0.83
R1856:Gabrb2	UTSW	11	42626713	missense	probably benign	0.01
R1898:Gabrb2	UTSW	11	42593832	missense	possibly damaging	0.51
R2184:Gabrb2	UTSW	11	42421428	critical splice donor site	probably null
R2371:Gabrb2	UTSW	11	42591864	missense	probably damaging	1.00
R2915:Gabrb2	UTSW	11	42591907	missense	probably benign
R2993:Gabrb2	UTSW	11	42597649	missense	probably damaging	0.99
R3951:Gabrb2	UTSW	11	42626881	missense	probably damaging	1.00
R4167:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4168:Gabrb2	UTSW	11	42421328	unclassified	probably benign
R4497:Gabrb2	UTSW	11	42597694	missense	probably benign	0.05
R4572:Gabrb2	UTSW	11	42593917	missense	possibly damaging	0.46
R4784:Gabrb2	UTSW	11	42597642	missense	probably damaging	1.00
R4792:Gabrb2	UTSW	11	42529503	splice site	probably benign
R5345:Gabrb2	UTSW	11	42626809	missense	possibly damaging	0.54
R5346:Gabrb2	UTSW	11	42421389	missense	probably benign
R5575:Gabrb2	UTSW	11	42529538	intron	probably benign
R5701:Gabrb2	UTSW	11	42487374	missense	probably damaging	1.00
R5801:Gabrb2	UTSW	11	42421389	missense	probably benign	0.00
R5965:Gabrb2	UTSW	11	42626869	missense	probably damaging	1.00
R6930:Gabrb2	UTSW	11	42597613	missense	probably damaging	1.00
R7011:Gabrb2	UTSW	11	42626661	missense	possibly damaging	0.76
R7045:Gabrb2	UTSW	11	42593931	missense	probably damaging	1.00
R7615:Gabrb2	UTSW	11	42626742	missense	probably benign	0.06
R7653:Gabrb2	UTSW	11	42487212	missense	probably damaging	1.00
R7866:Gabrb2	UTSW	11	42487223	nonsense	probably null
R8094:Gabrb2	UTSW	11	42597543	missense	probably damaging	0.98
R8402:Gabrb2	UTSW	11	42487304	missense	probably damaging	1.00
R8488:Gabrb2	UTSW	11	42626664	missense	possibly damaging	0.85
RF008:Gabrb2	UTSW	11	42626878	missense	probably damaging	1.00
X0020:Gabrb2	UTSW	11	42422646	missense	probably benign	0.26

Predicted Primers

PCR Primer
(F):5'- TAAAACACCTGGGATCTCAGAC -3'
(R):5'- ACCGCAAAATTCTGTGTGAGG -3'

Sequencing Primer
(F):5'- CACCTGGGATCTCAGACTATATTTAC -3'
(R):5'- CCGCAAAATTCTGTGTGAGGAAAGG -3'

Posted On

2018-08-01