Mutagenetix > Incidental Mutation

Incidental Mutation 'R6738:Cyp11b2'

530332

Institutional Source

Beutler Lab

Gene Symbol

Cyp11b2

Ensembl Gene

ENSMUSG00000022589

Gene Name

cytochrome P450, family 11, subfamily b, polypeptide 2

Synonyms

Cyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R6738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74851010-74856318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74853514 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 252 (T252I)

Ref Sequence

ENSEMBL: ENSMUSP00000131503 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167634]

AlphaFold

P15539

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167634
AA Change: T252I

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: T252I

Domain	Start	End	E-Value	Type
low complexity region	22	33	N/A	INTRINSIC
Pfam:p450	44	498	1e-115	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	G	A	1: 93,159,985	L49F	probably benign	Het
Abat	C	T	16: 8,602,436		probably benign	Het
Abl1	T	C	2: 31,794,574	Y454H	probably damaging	Het
Ambp	A	T	4: 63,149,474	D166E	probably benign	Het
Amigo2	A	G	15: 97,245,464	V359A	possibly damaging	Het
Ankrd11	A	T	8: 122,891,921	S1710T	probably damaging	Het
Ankrd31	T	C	13: 96,904,127	S1713P	possibly damaging	Het
Arhgap45	A	T	10: 80,027,597	K758M	probably damaging	Het
Bclaf1	T	C	10: 20,323,769	I304T	possibly damaging	Het
C1ra	A	G	6: 124,517,759	Y327C	probably damaging	Het
Ccdc73	C	T	2: 104,992,088	S794L	probably benign	Het
Cd24a	A	G	10: 43,582,676	N48D	possibly damaging	Het
Col11a1	A	G	3: 114,112,467		probably benign	Het
Dlx2	A	G	2: 71,546,062	Y111H	probably benign	Het
Dsp	T	C	13: 38,192,210	S1324P	possibly damaging	Het
Esyt3	A	T	9: 99,320,293	F522I	probably damaging	Het
Fam193b	C	T	13: 55,550,361	A45T	probably benign	Het
Flnb	A	G	14: 7,904,536	T980A	probably benign	Het
Gabrb2	G	T	11: 42,593,931	A272S	possibly damaging	Het
H2al2a	G	T	2: 17,996,618	Q86K	possibly damaging	Het
Ikbkb	T	G	8: 22,675,036	I243L	probably damaging	Het
Il18r1	A	G	1: 40,498,656	E527G	probably benign	Het
Krt35	A	T	11: 100,093,709	V320D	probably damaging	Het
Krt76	C	T	15: 101,887,478	R419H	probably benign	Het
Lrp2	T	A	2: 69,458,488	Y3678F	probably damaging	Het
Mnat1	T	G	12: 73,272,472	S290A	probably benign	Het
Mptx2	T	C	1: 173,274,855	E89G	probably benign	Het
Myom1	T	A	17: 71,100,398		probably null	Het
Naaladl2	A	G	3: 24,171,642	V541A	probably benign	Het
Nbeal2	T	C	9: 110,636,905	T851A	possibly damaging	Het
Ncoa4	A	G	14: 32,170,793	Y11C	probably benign	Het
Ntn5	T	A	7: 45,694,356		probably null	Het
Olfr347	C	T	2: 36,734,432	T37I	probably benign	Het
Olfr961	A	G	9: 39,646,661		probably benign	Het
Otop2	A	G	11: 115,329,492	Y386C	probably damaging	Het
Ppp2r1a	T	A	17: 20,954,717		probably null	Het
Prkd2	C	A	7: 16,865,905	N764K	possibly damaging	Het
Ralgapa1	A	G	12: 55,762,727	L421S	probably damaging	Het
Ric3	G	A	7: 109,048,062	R184*	probably null	Het
Sfswap	A	G	5: 129,541,441	K480E	probably damaging	Het
Siah2	A	G	3: 58,691,553	V88A	probably benign	Het
Slc22a16	T	C	10: 40,585,302	F367L	probably damaging	Het
Slc23a2	T	C	2: 132,078,436	D183G	probably benign	Het
Svep1	T	C	4: 58,123,180	N712S	possibly damaging	Het
Tex21	A	G	12: 76,239,509	V72A	probably benign	Het
Tfap4	A	G	16: 4,549,447	Y184H	probably damaging	Het
Timeless	T	C	10: 128,240,635	Y138H	probably damaging	Het
Tln2	A	T	9: 67,386,664	N227K	possibly damaging	Het
Trip10	C	T	17: 57,256,899	P342S	probably benign	Het
Ttc6	A	T	12: 57,688,640	E1156V	probably damaging	Het
Ttn	T	C	2: 76,898,128		probably benign	Het
Vmn2r109	G	A	17: 20,554,523	S190L	possibly damaging	Het
Wdr54	A	G	6: 83,155,127	S99P	probably damaging	Het
Ythdf2	A	C	4: 132,204,961	I296R	probably benign	Het
Zfp445	A	G	9: 122,862,058	V24A	probably damaging	Het

Other mutations in Cyp11b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00885:Cyp11b2	APN	15	74853515	missense	probably benign	0.00
IGL02058:Cyp11b2	APN	15	74853189	missense	probably benign	0.30
IGL02419:Cyp11b2	APN	15	74851055	missense	probably damaging	1.00
IGL03094:Cyp11b2	APN	15	74853037	critical splice donor site	probably null
IGL03237:Cyp11b2	APN	15	74851065	missense	probably benign	0.00
Spargel	UTSW	15	74851432	missense	probably damaging	1.00
stickfigure	UTSW	15	74851570	missense	possibly damaging	0.46
Stringbean	UTSW	15	74853130	missense	probably damaging	1.00
veronica	UTSW	15	74853991	missense	probably damaging	1.00
PIT4243001:Cyp11b2	UTSW	15	74851453	missense	probably damaging	1.00
R0522:Cyp11b2	UTSW	15	74851684	splice site	probably benign
R0674:Cyp11b2	UTSW	15	74855544	missense	probably damaging	1.00
R0837:Cyp11b2	UTSW	15	74853641	missense	probably damaging	1.00
R1386:Cyp11b2	UTSW	15	74851775	critical splice acceptor site	probably null
R1423:Cyp11b2	UTSW	15	74853130	missense	probably damaging	1.00
R1550:Cyp11b2	UTSW	15	74853593	missense	probably benign	0.07
R3437:Cyp11b2	UTSW	15	74855449	missense	probably benign
R3693:Cyp11b2	UTSW	15	74856008	missense	probably benign	0.00
R4447:Cyp11b2	UTSW	15	74855563	missense	probably benign	0.00
R4870:Cyp11b2	UTSW	15	74853146	missense	probably benign	0.00
R4947:Cyp11b2	UTSW	15	74851570	missense	possibly damaging	0.46
R4968:Cyp11b2	UTSW	15	74854005	splice site	probably null
R5115:Cyp11b2	UTSW	15	74855428	critical splice donor site	probably null
R5775:Cyp11b2	UTSW	15	74853478	missense	probably benign	0.02
R6841:Cyp11b2	UTSW	15	74855491	missense	probably benign	0.00
R6942:Cyp11b2	UTSW	15	74856245	start gained	probably benign
R6997:Cyp11b2	UTSW	15	74851432	missense	probably damaging	1.00
R7094:Cyp11b2	UTSW	15	74853658	missense	possibly damaging	0.94
R7096:Cyp11b2	UTSW	15	74855988	missense	probably damaging	0.98
R7275:Cyp11b2	UTSW	15	74853991	missense	probably damaging	1.00
R7456:Cyp11b2	UTSW	15	74853530	missense	probably benign	0.01
R7604:Cyp11b2	UTSW	15	74853750	splice site	probably null
R8002:Cyp11b2	UTSW	15	74856032	missense	probably damaging	1.00
R8222:Cyp11b2	UTSW	15	74856210	missense	probably benign	0.03
R8346:Cyp11b2	UTSW	15	74851768	missense	probably damaging	1.00
R8349:Cyp11b2	UTSW	15	74851579	missense	possibly damaging	0.94
R8449:Cyp11b2	UTSW	15	74851579	missense	possibly damaging	0.94
R8537:Cyp11b2	UTSW	15	74856167	missense	probably benign	0.01
R8785:Cyp11b2	UTSW	15	74852112	missense	probably benign	0.44
R8824:Cyp11b2	UTSW	15	74856065	missense	probably damaging	1.00
R9072:Cyp11b2	UTSW	15	74853813	missense	possibly damaging	0.56
R9100:Cyp11b2	UTSW	15	74851146	missense	probably damaging	0.99
R9501:Cyp11b2	UTSW	15	74851112	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCTGGTAGGAACATGTTAG -3'
(R):5'- GTCTTGAGGACAGAGATTGCCC -3'

Sequencing Primer
(F):5'- CCTGGTAGGAACATGTTAGAAGAGC -3'
(R):5'- ACAGAGATTGCCCGCCTTAG -3'

Posted On

2018-08-01