Mutagenetix > Incidental Mutations

Incidental Mutation 'R6738:Krt76'

530334

Institutional Source

Beutler Lab

Gene Symbol

Krt76

Ensembl Gene

ENSMUSG00000075402

Gene Name

keratin 76

Synonyms

2310001L23Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6738 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101884351-101892920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101887478 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 419 (R419H)

Ref Sequence

ENSEMBL: ENSMUSP00000097754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100179]

Predicted Effect

probably benign
Transcript: ENSMUST00000100179
AA Change: R419H

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000097754
Gene: ENSMUSG00000075402
AA Change: R419H

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	16	161	5.7e-39	PFAM
Filament	164	479	2.12e-166	SMART
low complexity region	488	551	N/A	INTRINSIC
low complexity region	565	593	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196731

Meta Mutation Damage Score

0.2311

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes mutants exhibit abnormalities in the hair cycle, tail skin and pigmentation, in the epidermis, and in the sebaceous gland. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	G	A	1: 93,159,985	L49F	probably benign	Het
Abat	C	T	16: 8,602,436		probably benign	Het
Abl1	T	C	2: 31,794,574	Y454H	probably damaging	Het
Ambp	A	T	4: 63,149,474	D166E	probably benign	Het
Amigo2	A	G	15: 97,245,464	V359A	possibly damaging	Het
Ankrd11	A	T	8: 122,891,921	S1710T	probably damaging	Het
Ankrd31	T	C	13: 96,904,127	S1713P	possibly damaging	Het
Arhgap45	A	T	10: 80,027,597	K758M	probably damaging	Het
Bclaf1	T	C	10: 20,323,769	I304T	possibly damaging	Het
C1ra	A	G	6: 124,517,759	Y327C	probably damaging	Het
Ccdc73	C	T	2: 104,992,088	S794L	probably benign	Het
Cd24a	A	G	10: 43,582,676	N48D	possibly damaging	Het
Col11a1	A	G	3: 114,112,467		probably benign	Het
Cyp11b2	G	A	15: 74,853,514	T252I	possibly damaging	Het
Dlx2	A	G	2: 71,546,062	Y111H	probably benign	Het
Dsp	T	C	13: 38,192,210	S1324P	possibly damaging	Het
Esyt3	A	T	9: 99,320,293	F522I	probably damaging	Het
Fam193b	C	T	13: 55,550,361	A45T	probably benign	Het
Flnb	A	G	14: 7,904,536	T980A	probably benign	Het
Gabrb2	G	T	11: 42,593,931	A272S	possibly damaging	Het
H2al2a	G	T	2: 17,996,618	Q86K	possibly damaging	Het
Ikbkb	T	G	8: 22,675,036	I243L	probably damaging	Het
Il18r1	A	G	1: 40,498,656	E527G	probably benign	Het
Krt35	A	T	11: 100,093,709	V320D	probably damaging	Het
Lrp2	T	A	2: 69,458,488	Y3678F	probably damaging	Het
Mnat1	T	G	12: 73,272,472	S290A	probably benign	Het
Mptx2	T	C	1: 173,274,855	E89G	probably benign	Het
Myom1	T	A	17: 71,100,398		probably null	Het
Naaladl2	A	G	3: 24,171,642	V541A	probably benign	Het
Nbeal2	T	C	9: 110,636,905	T851A	possibly damaging	Het
Ncoa4	A	G	14: 32,170,793	Y11C	probably benign	Het
Ntn5	T	A	7: 45,694,356		probably null	Het
Olfr347	C	T	2: 36,734,432	T37I	probably benign	Het
Olfr961	A	G	9: 39,646,661		probably benign	Het
Otop2	A	G	11: 115,329,492	Y386C	probably damaging	Het
Ppp2r1a	T	A	17: 20,954,717		probably null	Het
Prkd2	C	A	7: 16,865,905	N764K	possibly damaging	Het
Ralgapa1	A	G	12: 55,762,727	L421S	probably damaging	Het
Ric3	G	A	7: 109,048,062	R184*	probably null	Het
Sfswap	A	G	5: 129,541,441	K480E	probably damaging	Het
Siah2	A	G	3: 58,691,553	V88A	probably benign	Het
Slc22a16	T	C	10: 40,585,302	F367L	probably damaging	Het
Slc23a2	T	C	2: 132,078,436	D183G	probably benign	Het
Svep1	T	C	4: 58,123,180	N712S	possibly damaging	Het
Tex21	A	G	12: 76,239,509	V72A	probably benign	Het
Tfap4	A	G	16: 4,549,447	Y184H	probably damaging	Het
Timeless	T	C	10: 128,240,635	Y138H	probably damaging	Het
Tln2	A	T	9: 67,386,664	N227K	possibly damaging	Het
Trip10	C	T	17: 57,256,899	P342S	probably benign	Het
Ttc6	A	T	12: 57,688,640	E1156V	probably damaging	Het
Ttn	T	C	2: 76,898,128		probably benign	Het
Vmn2r109	G	A	17: 20,554,523	S190L	possibly damaging	Het
Wdr54	A	G	6: 83,155,127	S99P	probably damaging	Het
Ythdf2	A	C	4: 132,204,961	I296R	probably benign	Het
Zfp445	A	G	9: 122,862,058	V24A	probably damaging	Het

Other mutations in Krt76

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Krt76	APN	15	101884888	missense	unknown
IGL01475:Krt76	APN	15	101888513	missense	probably benign	0.11
IGL01504:Krt76	APN	15	101888173	missense	probably damaging	1.00
IGL01506:Krt76	APN	15	101892400	missense	probably damaging	0.97
IGL01943:Krt76	APN	15	101889045	missense	probably null	0.98
IGL03164:Krt76	APN	15	101887451	missense	possibly damaging	0.50
PIT4378001:Krt76	UTSW	15	101892407	missense	probably damaging	0.99
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0105:Krt76	UTSW	15	101884912	missense	unknown
R0448:Krt76	UTSW	15	101890647	missense	probably damaging	1.00
R0730:Krt76	UTSW	15	101887349	missense	probably damaging	1.00
R0920:Krt76	UTSW	15	101892439	missense	possibly damaging	0.80
R1568:Krt76	UTSW	15	101885008	missense	unknown
R1779:Krt76	UTSW	15	101892687	missense	unknown
R1869:Krt76	UTSW	15	101889487	critical splice donor site	probably null
R1911:Krt76	UTSW	15	101888165	nonsense	probably null
R2160:Krt76	UTSW	15	101888385	missense	probably damaging	1.00
R2504:Krt76	UTSW	15	101884858	missense	unknown
R4487:Krt76	UTSW	15	101890482	missense	possibly damaging	0.71
R4729:Krt76	UTSW	15	101889081	missense	probably damaging	1.00
R4747:Krt76	UTSW	15	101885745	missense	probably damaging	1.00
R4912:Krt76	UTSW	15	101888162	nonsense	probably null
R5357:Krt76	UTSW	15	101887385	missense	probably benign	0.04
R7786:Krt76	UTSW	15	101890530	missense	probably damaging	0.98
R7808:Krt76	UTSW	15	101890494	missense	probably damaging	1.00
R7825:Krt76	UTSW	15	101887503	missense	possibly damaging	0.46
Z1088:Krt76	UTSW	15	101890551	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTACACTTGGAGAATGCTGAC -3'
(R):5'- ATTGCAACATCAACCTGACTTGTG -3'

Sequencing Primer
(F):5'- TTGGAGAATGCTGACCCCCAAG -3'
(R):5'- CAACCTGACTTGTGAACTTGAGC -3'

Posted On

2018-08-01