Incidental Mutation 'R6738:Tfap4'
ID530335
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R6738 (G1)
Quality Score133.008
Status Validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4549447 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 184 (Y184H)
Ref Sequence ENSEMBL: ENSMUSP00000005862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000229956] [ENSMUST00000230875]
Predicted Effect probably damaging
Transcript: ENSMUST00000005862
AA Change: Y184H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: Y184H

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229956
AA Change: Y164H

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000230875
AA Change: Y124H

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Ppp2r1a T A 17: 20,954,717 probably null Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
E0370:Tfap4 UTSW 16 4559470 missense possibly damaging 0.53
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4300:Tfap4 UTSW 16 4551360 missense probably damaging 0.99
R4371:Tfap4 UTSW 16 4551999 missense probably damaging 1.00
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R7678:Tfap4 UTSW 16 4551766 missense possibly damaging 0.53
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTACAGATTCTGAGAACCCCGC -3'
(R):5'- CAGCTAGTCAGTCAGAAGGG -3'

Sequencing Primer
(F):5'- gctctagcttctcctggt -3'
(R):5'- CAGCTAGTCAGTCAGAAGGGAAAGG -3'
Posted On2018-08-01