Incidental Mutation 'R6738:Ppp2r1a'
ID530338
Institutional Source Beutler Lab
Gene Symbol Ppp2r1a
Ensembl Gene ENSMUSG00000007564
Gene Nameprotein phosphatase 2, regulatory subunit A, alpha
SynonymsPR65, PP2A, 6330556D22Rik, protein phosphatase PP2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6738 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20945311-20965916 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 20954717 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000007708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007708] [ENSMUST00000147983] [ENSMUST00000173658]
PDB Structure
Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. [X-RAY DIFFRACTION]
Crystal structure of the full-length simian virus 40 small t antigen complexed with the protein phosphatase 2A Aalpha subunit [X-RAY DIFFRACTION]
Structural Basis of PP2A and Sgo interaction [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000007708
SMART Domains Protein: ENSMUSP00000007708
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 166 196 4.3e-6 PFAM
Pfam:HEAT_2 170 266 1.7e-8 PFAM
Pfam:HEAT 283 313 3.4e-5 PFAM
Pfam:HEAT_2 366 467 5.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136975
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139293
Predicted Effect probably benign
Transcript: ENSMUST00000147983
SMART Domains Protein: ENSMUSP00000133334
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
Pfam:HEAT 13 43 2.1e-5 PFAM
Pfam:HEAT 52 82 2.9e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173359
Predicted Effect probably benign
Transcript: ENSMUST00000173658
SMART Domains Protein: ENSMUSP00000133778
Gene: ENSMUSG00000007564

DomainStartEndE-ValueType
PDB:2PF4|D 1 72 3e-40 PDB
SCOP:d1b3ua_ 2 86 3e-12 SMART
Meta Mutation Damage Score 0.9504 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a constant regulatory subunit of protein phosphatase 2. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The constant regulatory subunit A serves as a scaffolding molecule to coordinate the assembly of the catalytic subunit and a variable regulatory B subunit. This gene encodes an alpha isoform of the constant regulatory subunit A. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a targeted allele that remove exons 5 and 6 exhibit embryonic lethality. Mice heterozygous for this allele exhibit increased benzopyrene-induced lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik G A 1: 93,159,985 L49F probably benign Het
Abat C T 16: 8,602,436 probably benign Het
Abl1 T C 2: 31,794,574 Y454H probably damaging Het
Ambp A T 4: 63,149,474 D166E probably benign Het
Amigo2 A G 15: 97,245,464 V359A possibly damaging Het
Ankrd11 A T 8: 122,891,921 S1710T probably damaging Het
Ankrd31 T C 13: 96,904,127 S1713P possibly damaging Het
Arhgap45 A T 10: 80,027,597 K758M probably damaging Het
Bclaf1 T C 10: 20,323,769 I304T possibly damaging Het
C1ra A G 6: 124,517,759 Y327C probably damaging Het
Ccdc73 C T 2: 104,992,088 S794L probably benign Het
Cd24a A G 10: 43,582,676 N48D possibly damaging Het
Col11a1 A G 3: 114,112,467 probably benign Het
Cyp11b2 G A 15: 74,853,514 T252I possibly damaging Het
Dlx2 A G 2: 71,546,062 Y111H probably benign Het
Dsp T C 13: 38,192,210 S1324P possibly damaging Het
Esyt3 A T 9: 99,320,293 F522I probably damaging Het
Fam193b C T 13: 55,550,361 A45T probably benign Het
Flnb A G 14: 7,904,536 T980A probably benign Het
Gabrb2 G T 11: 42,593,931 A272S possibly damaging Het
H2al2a G T 2: 17,996,618 Q86K possibly damaging Het
Ikbkb T G 8: 22,675,036 I243L probably damaging Het
Il18r1 A G 1: 40,498,656 E527G probably benign Het
Krt35 A T 11: 100,093,709 V320D probably damaging Het
Krt76 C T 15: 101,887,478 R419H probably benign Het
Lrp2 T A 2: 69,458,488 Y3678F probably damaging Het
Mnat1 T G 12: 73,272,472 S290A probably benign Het
Mptx2 T C 1: 173,274,855 E89G probably benign Het
Myom1 T A 17: 71,100,398 probably null Het
Naaladl2 A G 3: 24,171,642 V541A probably benign Het
Nbeal2 T C 9: 110,636,905 T851A possibly damaging Het
Ncoa4 A G 14: 32,170,793 Y11C probably benign Het
Ntn5 T A 7: 45,694,356 probably null Het
Olfr347 C T 2: 36,734,432 T37I probably benign Het
Olfr961 A G 9: 39,646,661 probably benign Het
Otop2 A G 11: 115,329,492 Y386C probably damaging Het
Prkd2 C A 7: 16,865,905 N764K possibly damaging Het
Ralgapa1 A G 12: 55,762,727 L421S probably damaging Het
Ric3 G A 7: 109,048,062 R184* probably null Het
Sfswap A G 5: 129,541,441 K480E probably damaging Het
Siah2 A G 3: 58,691,553 V88A probably benign Het
Slc22a16 T C 10: 40,585,302 F367L probably damaging Het
Slc23a2 T C 2: 132,078,436 D183G probably benign Het
Svep1 T C 4: 58,123,180 N712S possibly damaging Het
Tex21 A G 12: 76,239,509 V72A probably benign Het
Tfap4 A G 16: 4,549,447 Y184H probably damaging Het
Timeless T C 10: 128,240,635 Y138H probably damaging Het
Tln2 A T 9: 67,386,664 N227K possibly damaging Het
Trip10 C T 17: 57,256,899 P342S probably benign Het
Ttc6 A T 12: 57,688,640 E1156V probably damaging Het
Ttn T C 2: 76,898,128 probably benign Het
Vmn2r109 G A 17: 20,554,523 S190L possibly damaging Het
Wdr54 A G 6: 83,155,127 S99P probably damaging Het
Ythdf2 A C 4: 132,204,961 I296R probably benign Het
Zfp445 A G 9: 122,862,058 V24A probably damaging Het
Other mutations in Ppp2r1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ppp2r1a APN 17 20961578 unclassified probably benign
IGL01815:Ppp2r1a APN 17 20956832 missense probably benign 0.00
IGL01923:Ppp2r1a APN 17 20965469 makesense probably null
IGL02411:Ppp2r1a APN 17 20951334 splice site probably benign
IGL02694:Ppp2r1a APN 17 20951440 splice site probably benign
IGL02742:Ppp2r1a APN 17 20959003 missense probably benign 0.01
Dolmas UTSW 17 20960631 nonsense probably null
R0032:Ppp2r1a UTSW 17 20945584 critical splice donor site probably benign
R0403:Ppp2r1a UTSW 17 20957041 missense probably damaging 0.96
R1170:Ppp2r1a UTSW 17 20951331 splice site probably benign
R1652:Ppp2r1a UTSW 17 20955974 missense probably benign 0.03
R1857:Ppp2r1a UTSW 17 20961689 missense possibly damaging 0.93
R2215:Ppp2r1a UTSW 17 20961743 splice site probably null
R3800:Ppp2r1a UTSW 17 20962710 missense possibly damaging 0.82
R4013:Ppp2r1a UTSW 17 20951347 missense probably damaging 1.00
R4483:Ppp2r1a UTSW 17 20955810 missense probably benign 0.05
R5014:Ppp2r1a UTSW 17 20958839 splice site probably null
R5421:Ppp2r1a UTSW 17 20956706 missense probably benign
R5615:Ppp2r1a UTSW 17 20958987 missense probably benign 0.00
R5945:Ppp2r1a UTSW 17 20959413 missense possibly damaging 0.81
R5986:Ppp2r1a UTSW 17 20951346 missense probably damaging 1.00
R6466:Ppp2r1a UTSW 17 20960631 nonsense probably null
R6727:Ppp2r1a UTSW 17 20955825 missense probably benign 0.07
R6934:Ppp2r1a UTSW 17 20961633 missense possibly damaging 0.56
R7549:Ppp2r1a UTSW 17 20962682 missense possibly damaging 0.95
R7904:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7987:Ppp2r1a UTSW 17 20961741 critical splice donor site probably null
R7998:Ppp2r1a UTSW 17 20961639 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATAGGGGTGCTGACATCGAG -3'
(R):5'- CCTACAGGTAGAGTGCTACTGAG -3'

Sequencing Primer
(F):5'- TGCTGACATCGAGGAAGCTTG -3'
(R):5'- CAGGTAGAGTGCTACTGAGTCCTAG -3'
Posted On2018-08-01