Mutagenetix > Incidental Mutation

Incidental Mutation 'R6739:Arhgap21'

530344

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

044857-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R6739 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20852730-20973692 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20885543 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 545 (H545Y)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114594
AA Change: H549Y

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: H549Y

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141298
AA Change: H555Y

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: H555Y

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154230
AA Change: H555Y

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: H555Y

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173194
AA Change: H545Y

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: H545Y

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: H384Y

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: H384Y

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.1414

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	A	G	16: 4,236,658 (GRCm39)	V14A	probably benign	Het
Ank2	A	T	3: 126,873,643 (GRCm39)	N59K	probably damaging	Het
Ano4	T	C	10: 88,863,114 (GRCm39)	Y286C	probably damaging	Het
Arid1a	T	A	4: 133,414,937 (GRCm39)	S1152C	unknown	Het
Cfap73	T	C	5: 120,768,258 (GRCm39)	T167A	probably benign	Het
Ctbs	A	T	3: 146,165,254 (GRCm39)		probably null	Het
Dmgdh	T	A	13: 93,857,123 (GRCm39)	N742K	probably benign	Het
Dmxl1	T	C	18: 50,011,313 (GRCm39)	S1157P	probably benign	Het
Dnm3	T	C	1: 162,305,352 (GRCm39)	N14S	probably damaging	Het
Dpp4	C	T	2: 62,217,439 (GRCm39)	V53I	probably benign	Het
Etl4	A	G	2: 20,718,246 (GRCm39)	N329S	probably damaging	Het
Fbxw25	A	G	9: 109,480,699 (GRCm39)	V327A	probably benign	Het
Gsg1	T	A	6: 135,214,612 (GRCm39)	Q299L	probably damaging	Het
Igsf23	A	G	7: 19,678,673 (GRCm39)	L39P	probably damaging	Het
Il17rd	A	G	14: 26,821,488 (GRCm39)	R261G	possibly damaging	Het
Krt75	C	T	15: 101,479,503 (GRCm39)	D276N	probably benign	Het
Lox	T	C	18: 52,660,031 (GRCm39)	T268A	possibly damaging	Het
Mroh4	T	C	15: 74,481,568 (GRCm39)	S825G	probably benign	Het
Nlrp9c	T	C	7: 26,084,850 (GRCm39)	D243G	probably damaging	Het
Or10a5	T	C	7: 106,636,018 (GRCm39)	Y219H	probably damaging	Het
Or1x6	T	A	11: 50,939,564 (GRCm39)	V210E	probably damaging	Het
Picalm	C	A	7: 89,825,916 (GRCm39)	T131N	probably damaging	Het
Pitpnm1	T	A	19: 4,160,522 (GRCm39)	L781H	probably damaging	Het
Proz	A	T	8: 13,123,451 (GRCm39)	I241F	possibly damaging	Het
Rb1cc1	A	G	1: 6,304,454 (GRCm39)	D67G	probably damaging	Het
Rnf213	T	A	11: 119,333,097 (GRCm39)	C2769S	probably damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,229,116 (GRCm39)		probably benign	Het
Scn8a	T	C	15: 100,913,836 (GRCm39)	I1076T	possibly damaging	Het
Snrnp70	A	T	7: 45,036,843 (GRCm39)	D100E	probably damaging	Het
Triobp	T	A	15: 78,850,566 (GRCm39)	L240Q	possibly damaging	Het
Vmn2r5	A	G	3: 64,398,637 (GRCm39)	S781P	probably damaging	Het
Zfp451	A	G	1: 33,842,675 (GRCm39)		probably benign	Het
Zfta	C	T	19: 7,398,712 (GRCm39)	R243*	probably null	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20,860,511 (GRCm39)	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20,854,392 (GRCm39)	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20,919,455 (GRCm39)	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20,854,448 (GRCm39)	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20,884,813 (GRCm39)	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20,885,117 (GRCm39)	missense	probably benign
IGL02264:Arhgap21	APN	2	20,864,850 (GRCm39)	splice site	probably null
IGL02346:Arhgap21	APN	2	20,884,762 (GRCm39)	splice site	probably benign
IGL02418:Arhgap21	APN	2	20,885,711 (GRCm39)	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20,860,399 (GRCm39)	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20,896,902 (GRCm39)	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20,865,874 (GRCm39)	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20,919,532 (GRCm39)	missense	probably benign
IGL03265:Arhgap21	APN	2	20,854,439 (GRCm39)	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20,885,500 (GRCm39)	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20,864,612 (GRCm39)	splice site	probably benign
R0363:Arhgap21	UTSW	2	20,885,944 (GRCm39)	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20,867,928 (GRCm39)	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20,919,610 (GRCm39)	nonsense	probably null
R0633:Arhgap21	UTSW	2	20,860,198 (GRCm39)	nonsense	probably null
R0905:Arhgap21	UTSW	2	20,854,745 (GRCm39)	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20,886,576 (GRCm39)	nonsense	probably null
R1570:Arhgap21	UTSW	2	20,885,651 (GRCm39)	missense	probably benign
R1686:Arhgap21	UTSW	2	20,886,659 (GRCm39)	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20,865,910 (GRCm39)	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20,854,331 (GRCm39)	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20,886,451 (GRCm39)	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2336:Arhgap21	UTSW	2	20,884,862 (GRCm39)	missense	probably damaging	1.00
R2516:Arhgap21	UTSW	2	20,859,809 (GRCm39)	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20,855,102 (GRCm39)	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20,864,717 (GRCm39)	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20,896,915 (GRCm39)	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20,972,146 (GRCm39)	missense	probably benign
R4686:Arhgap21	UTSW	2	20,868,033 (GRCm39)	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20,854,967 (GRCm39)	missense	probably benign
R4834:Arhgap21	UTSW	2	20,870,130 (GRCm39)	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20,885,998 (GRCm39)	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20,885,279 (GRCm39)	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20,854,872 (GRCm39)	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20,863,800 (GRCm39)	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20,854,701 (GRCm39)	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20,884,848 (GRCm39)	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20,853,645 (GRCm39)	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20,854,127 (GRCm39)	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20,854,533 (GRCm39)	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20,885,897 (GRCm39)	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20,885,497 (GRCm39)	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20,868,024 (GRCm39)	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20,853,852 (GRCm39)	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20,886,187 (GRCm39)	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20,886,616 (GRCm39)	missense	probably damaging	1.00
R6817:Arhgap21	UTSW	2	20,885,107 (GRCm39)	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20,853,659 (GRCm39)	missense	probably benign
R6844:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20,885,321 (GRCm39)	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20,855,142 (GRCm39)	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20,853,689 (GRCm39)	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20,870,198 (GRCm39)	missense	probably benign
R7237:Arhgap21	UTSW	2	20,854,783 (GRCm39)	nonsense	probably null
R7261:Arhgap21	UTSW	2	20,885,177 (GRCm39)	missense	probably benign
R7558:Arhgap21	UTSW	2	20,860,421 (GRCm39)	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20,917,102 (GRCm39)	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20,855,169 (GRCm39)	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20,854,290 (GRCm39)	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20,867,983 (GRCm39)	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20,885,524 (GRCm39)	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20,854,007 (GRCm39)	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20,867,967 (GRCm39)	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20,885,216 (GRCm39)	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20,854,221 (GRCm39)	missense	probably benign
R8486:Arhgap21	UTSW	2	20,865,236 (GRCm39)	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20,858,991 (GRCm39)	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20,972,144 (GRCm39)	nonsense	probably null
R9140:Arhgap21	UTSW	2	20,886,025 (GRCm39)	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20,858,983 (GRCm39)	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20,885,816 (GRCm39)	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20,854,061 (GRCm39)	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20,885,464 (GRCm39)	missense	probably benign
R9454:Arhgap21	UTSW	2	20,870,153 (GRCm39)	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20,896,953 (GRCm39)	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20,854,026 (GRCm39)	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20,886,283 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- TACTTCGGACTTTCACGAGTGG -3'
(R):5'- AATCATAGAACTCGTTCGTGGG -3'

Sequencing Primer
(F):5'- TGCAATACCCCGTTGAAGTG -3'
(R):5'- CATAGAACTCGTTCGTGGGATTAC -3'

Posted On

2018-08-01