Incidental Mutation 'R6739:Igsf23'
ID530351
Institutional Source Beutler Lab
Gene Symbol Igsf23
Ensembl Gene ENSMUSG00000040498
Gene Nameimmunoglobulin superfamily, member 23
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19937305-19950756 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19944748 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000147077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043440] [ENSMUST00000208974]
Predicted Effect probably damaging
Transcript: ENSMUST00000043440
AA Change: L77P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047914
Gene: ENSMUSG00000040498
AA Change: L77P

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IG 107 181 2.71e0 SMART
low complexity region 182 195 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208210
Predicted Effect probably damaging
Transcript: ENSMUST00000208974
AA Change: L39P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has one immunoglobulin (Ig) domain and is a member of the immunoglobulin superfamily. Proteins in this superfamily are usually found on or in cell membranes and act as receptors in immune response pathways. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Igsf23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Igsf23 APN 7 19938236 utr 3 prime probably benign
R0334:Igsf23 UTSW 7 19941753 missense probably benign 0.27
R0831:Igsf23 UTSW 7 19941737 splice site probably benign
R2351:Igsf23 UTSW 7 19944798 nonsense probably null
R4835:Igsf23 UTSW 7 19941830 missense possibly damaging 0.80
R4850:Igsf23 UTSW 7 19953934 unclassified probably benign
R6924:Igsf23 UTSW 7 19941759 missense possibly damaging 0.83
R8244:Igsf23 UTSW 7 19941873 missense possibly damaging 0.66
R8285:Igsf23 UTSW 7 19941956 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTCTGAGAATGGGCCCCAC -3'
(R):5'- AGTATGTCACCTGTGGTCTCAC -3'

Sequencing Primer
(F):5'- ATGGGCCCCACTCACACTTC -3'
(R):5'- ATGTCACCTGTGGTCTCACTTGTC -3'
Posted On2018-08-01