Incidental Mutation 'R6739:Snrnp70'
ID530353
Institutional Source Beutler Lab
Gene Symbol Snrnp70
Ensembl Gene ENSMUSG00000063511
Gene Namesmall nuclear ribonucleoprotein 70 (U1)
SynonymsSrnp70, 2700022N21Rik, Rnulp70, Snrp70, U1-70, 3200002N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45376453-45395742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45387419 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 100 (D100E)
Ref Sequence ENSEMBL: ENSMUSP00000147400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074575] [ENSMUST00000209858] [ENSMUST00000210514] [ENSMUST00000211121] [ENSMUST00000211378] [ENSMUST00000211211]
Predicted Effect probably damaging
Transcript: ENSMUST00000074575
AA Change: D100E

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074160
Gene: ENSMUSG00000063511
AA Change: D100E

DomainStartEndE-ValueType
Pfam:U1snRNP70_N 2 94 4e-31 PFAM
RRM 104 177 1.62e-23 SMART
low complexity region 186 203 N/A INTRINSIC
coiled coil region 286 309 N/A INTRINSIC
low complexity region 331 409 N/A INTRINSIC
PDB:3PGW|L 410 448 4e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209237
Predicted Effect probably damaging
Transcript: ENSMUST00000209858
AA Change: D100E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect unknown
Transcript: ENSMUST00000209993
AA Change: D49E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210495
Predicted Effect probably benign
Transcript: ENSMUST00000210514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210970
Predicted Effect probably damaging
Transcript: ENSMUST00000211121
AA Change: D100E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211178
Predicted Effect unknown
Transcript: ENSMUST00000211378
AA Change: M102K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211290
Predicted Effect probably benign
Transcript: ENSMUST00000211211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211366
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a subunit of the U1 snRNP (small nuclear ribonucleic particle), one of at least five snRNPs to comprise the spliceosome, which functions in processing of pre-mRNAs. The U1 snRNP has been shown to be important in defining the 5' splice site. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Snrnp70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Snrnp70 APN 7 45377354 critical splice donor site probably null
IGL01092:Snrnp70 APN 7 45377377 missense probably damaging 0.98
IGL01444:Snrnp70 APN 7 45387236 splice site probably null
IGL03110:Snrnp70 APN 7 45376859 intron probably benign
R0691:Snrnp70 UTSW 7 45387245 missense possibly damaging 0.60
R1371:Snrnp70 UTSW 7 45380705 unclassified probably benign
R1854:Snrnp70 UTSW 7 45377220 nonsense probably null
R1880:Snrnp70 UTSW 7 45377362 splice site probably null
R2050:Snrnp70 UTSW 7 45387300 nonsense probably null
R4928:Snrnp70 UTSW 7 45377281 splice site probably null
R5195:Snrnp70 UTSW 7 45394710 missense probably damaging 1.00
R5314:Snrnp70 UTSW 7 45377052 nonsense probably null
R5326:Snrnp70 UTSW 7 45377233 intron probably benign
R5522:Snrnp70 UTSW 7 45377177 intron probably benign
R6182:Snrnp70 UTSW 7 45377073 nonsense probably null
R7607:Snrnp70 UTSW 7 45392264 missense possibly damaging 0.82
R7789:Snrnp70 UTSW 7 45376621 nonsense probably null
R7840:Snrnp70 UTSW 7 45376790 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAACTCTCCAGCTGGACAC -3'
(R):5'- GTGAAACCAGACCTGAAACATG -3'

Sequencing Primer
(F):5'- GACACACTTACTCTTTTGATGGG -3'
(R):5'- GTACTCACGCTTACTAAGTCACTGAG -3'
Posted On2018-08-01