Incidental Mutation 'R6739:Olfr713'
ID530356
Institutional Source Beutler Lab
Gene Symbol Olfr713
Ensembl Gene ENSMUSG00000073898
Gene Nameolfactory receptor 713
SynonymsGA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107031174-107040994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107036811 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 219 (Y219H)
Ref Sequence ENSEMBL: ENSMUSP00000150042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098139] [ENSMUST00000213623]
Predicted Effect probably damaging
Transcript: ENSMUST00000098139
AA Change: Y226H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095743
Gene: ENSMUSG00000073898
AA Change: Y226H

DomainStartEndE-ValueType
Pfam:7tm_4 39 316 4.4e-57 PFAM
Pfam:7tm_1 49 298 2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213623
AA Change: Y219H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal olfactory sensory neuron projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Olfr713
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Olfr713 APN 7 107036847 missense probably damaging 0.99
IGL01630:Olfr713 APN 7 107037111 utr 3 prime probably benign
IGL02539:Olfr713 APN 7 107036434 missense probably damaging 1.00
IGL02727:Olfr713 APN 7 107036695 missense probably damaging 1.00
IGL03336:Olfr713 APN 7 107036335 missense probably damaging 1.00
R0501:Olfr713 UTSW 7 107036232 missense probably benign
R0684:Olfr713 UTSW 7 107036682 missense probably damaging 1.00
R0909:Olfr713 UTSW 7 107036194 missense probably benign 0.19
R1481:Olfr713 UTSW 7 107036149 missense probably benign 0.05
R1958:Olfr713 UTSW 7 107036271 missense possibly damaging 0.77
R1965:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R2119:Olfr713 UTSW 7 107036731 missense probably damaging 1.00
R2149:Olfr713 UTSW 7 107036338 missense possibly damaging 0.68
R3012:Olfr713 UTSW 7 107036362 missense possibly damaging 0.79
R3428:Olfr713 UTSW 7 107036716 missense probably benign
R4425:Olfr713 UTSW 7 107036491 missense probably damaging 1.00
R4795:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4796:Olfr713 UTSW 7 107036914 missense probably benign 0.00
R4908:Olfr713 UTSW 7 107036157 start codon destroyed probably benign 0.02
R4945:Olfr713 UTSW 7 107036319 missense probably benign 0.00
R5122:Olfr713 UTSW 7 107036848 nonsense probably null
R5721:Olfr713 UTSW 7 107036358 missense probably damaging 1.00
R5979:Olfr713 UTSW 7 107036336 missense probably damaging 1.00
R6981:Olfr713 UTSW 7 107036749 missense possibly damaging 0.77
R7197:Olfr713 UTSW 7 107036157 missense probably benign 0.03
R7228:Olfr713 UTSW 7 107037100 missense probably benign
R7444:Olfr713 UTSW 7 107036347 missense probably damaging 1.00
R8830:Olfr713 UTSW 7 107036682 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TGCAGACCACATGGCTCTTC -3'
(R):5'- GCTATAGATGATGGGGTTCAACATG -3'

Sequencing Primer
(F):5'- AGACCACATGGCTCTTCAGTTTTC -3'
(R):5'- GTTCAACATGGGAGTCACAAC -3'
Posted On2018-08-01