Incidental Mutation 'R6739:Proz'
ID530357
Institutional Source Beutler Lab
Gene Symbol Proz
Ensembl Gene ENSMUSG00000031445
Gene Nameprotein Z, vitamin K-dependent plasma glycoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13060914-13076026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13073451 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 241 (I241F)
Ref Sequence ENSEMBL: ENSMUSP00000033822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033822] [ENSMUST00000164416] [ENSMUST00000168164] [ENSMUST00000211363] [ENSMUST00000211453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033822
AA Change: I241F

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000033822
Gene: ENSMUSG00000031445
AA Change: I241F

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
GLA 22 86 7.03e-29 SMART
EGF 90 123 1.65e-6 SMART
EGF 128 166 1.19e-3 SMART
Tryp_SPc 182 394 6.49e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164416
SMART Domains Protein: ENSMUSP00000133204
Gene: ENSMUSG00000038542

DomainStartEndE-ValueType
PAM 144 312 4.29e-68 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165885
Predicted Effect probably benign
Transcript: ENSMUST00000168164
Predicted Effect probably benign
Transcript: ENSMUST00000211363
Predicted Effect probably benign
Transcript: ENSMUST00000211453
Meta Mutation Damage Score 0.5992 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: When unchallenged, mice homozygous for a knock-out allele do not express an obvious phenotype; however, homozygotes exhibit significantly reduced survival following collagen/epinephrine-induced thromboembolism and develop enhanced thrombosis in the ferric chloride-induced arterial injury model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Proz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Proz APN 8 13065238 splice site probably benign
IGL01977:Proz APN 8 13066913 missense probably damaging 1.00
IGL02553:Proz APN 8 13065260 missense probably benign 0.00
IGL02991:Proz UTSW 8 13073490 missense probably benign 0.00
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0241:Proz UTSW 8 13065356 missense probably benign 0.02
R0482:Proz UTSW 8 13073460 nonsense probably null
R1614:Proz UTSW 8 13066904 missense probably damaging 1.00
R1906:Proz UTSW 8 13073686 splice site probably null
R2230:Proz UTSW 8 13063356 missense probably damaging 0.99
R2232:Proz UTSW 8 13063356 missense probably damaging 0.99
R2444:Proz UTSW 8 13061027 start gained probably benign
R3029:Proz UTSW 8 13061042 missense probably benign
R3847:Proz UTSW 8 13073533 missense probably benign 0.00
R3850:Proz UTSW 8 13073533 missense probably benign 0.00
R4063:Proz UTSW 8 13064621 missense probably damaging 1.00
R5104:Proz UTSW 8 13066931 missense probably damaging 1.00
R5309:Proz UTSW 8 13061049 missense probably damaging 1.00
R5337:Proz UTSW 8 13066854 missense probably benign 0.01
R5447:Proz UTSW 8 13072578 missense probably benign 0.31
R5876:Proz UTSW 8 13073448 missense probably benign 0.05
R7559:Proz UTSW 8 13063455 missense probably benign 0.01
R7842:Proz UTSW 8 13063406 missense probably benign 0.19
R7867:Proz UTSW 8 13061027 start gained probably benign
R8676:Proz UTSW 8 13073630 missense probably damaging 1.00
R8820:Proz UTSW 8 13063253 missense probably damaging 1.00
R8936:Proz UTSW 8 13065319 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACAGTGAAATGAGTGGGCTC -3'
(R):5'- TCTGCTTGTGTGACCGACAG -3'

Sequencing Primer
(F):5'- GGGCTCAGCTCACTTTGATC -3'
(R):5'- GTGTGCCATTAAGCATCCAG -3'
Posted On2018-08-01