Incidental Mutation 'R6739:Fbxw25'
ID530358
Institutional Source Beutler Lab
Gene Symbol Fbxw25
Ensembl Gene ENSMUSG00000094992
Gene NameF-box and WD-40 domain protein 25
SynonymsE330001B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109645122-109664652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109651631 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 327 (V327A)
Ref Sequence ENSEMBL: ENSMUSP00000128652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163839]
Predicted Effect probably benign
Transcript: ENSMUST00000163839
AA Change: V327A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128652
Gene: ENSMUSG00000094992
AA Change: V327A

DomainStartEndE-ValueType
FBOX 5 45 5.44e-6 SMART
SCOP:d1gxra_ 119 228 1e-6 SMART
Blast:WD40 137 176 6e-6 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Fbxw25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03330:Fbxw25 APN 9 109645239 missense probably benign 0.00
goodtimes UTSW 9 109663374 critical splice donor site probably null
shakeys UTSW 9 109654583 missense
R0158:Fbxw25 UTSW 9 109654652 missense possibly damaging 0.74
R0850:Fbxw25 UTSW 9 109649617 missense probably benign
R1109:Fbxw25 UTSW 9 109650060 missense probably benign 0.00
R1386:Fbxw25 UTSW 9 109654641 missense possibly damaging 0.77
R1609:Fbxw25 UTSW 9 109663510 missense probably benign 0.11
R1750:Fbxw25 UTSW 9 109650073 missense probably benign 0.23
R1977:Fbxw25 UTSW 9 109652856 missense possibly damaging 0.72
R2427:Fbxw25 UTSW 9 109652860 missense probably benign 0.09
R3841:Fbxw25 UTSW 9 109662134 nonsense probably null
R4356:Fbxw25 UTSW 9 109662085 missense probably damaging 1.00
R4934:Fbxw25 UTSW 9 109651637 missense possibly damaging 0.63
R5024:Fbxw25 UTSW 9 109663374 critical splice donor site probably null
R5175:Fbxw25 UTSW 9 109664563 missense probably damaging 1.00
R5323:Fbxw25 UTSW 9 109663505 missense probably benign 0.04
R5389:Fbxw25 UTSW 9 109652886 missense possibly damaging 0.95
R5493:Fbxw25 UTSW 9 109652916 missense probably benign 0.01
R6268:Fbxw25 UTSW 9 109654650 missense probably damaging 1.00
R7275:Fbxw25 UTSW 9 109654592 missense
R7492:Fbxw25 UTSW 9 109664530 critical splice donor site probably null
R7623:Fbxw25 UTSW 9 109654583 missense
R7784:Fbxw25 UTSW 9 109650119 missense
R7861:Fbxw25 UTSW 9 109664557 nonsense probably null
R7887:Fbxw25 UTSW 9 109649594 critical splice donor site probably null
X0023:Fbxw25 UTSW 9 109651775 missense possibly damaging 0.94
Z1176:Fbxw25 UTSW 9 109651738 missense
Predicted Primers PCR Primer
(F):5'- AAGCCATTTTCCACCCCATCTTA -3'
(R):5'- ACATCAGAATTCTCAGCCCCT -3'

Sequencing Primer
(F):5'- ACTGTATACATCAGGCTGGC -3'
(R):5'- AGAATTCTCAGCCCCTGTGTC -3'
Posted On2018-08-01