Incidental Mutation 'R6739:Ano4'
ID530359
Institutional Source Beutler Lab
Gene Symbol Ano4
Ensembl Gene ENSMUSG00000035189
Gene Nameanoctamin 4
SynonymsA330096O15Rik, Tmem16d
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_178773.4; MGI: 2443344

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location88948994-89344762 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89027252 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 286 (Y286C)
Ref Sequence ENSEMBL: ENSMUSP00000138325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182341] [ENSMUST00000182462] [ENSMUST00000182613] [ENSMUST00000182790]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182041
Predicted Effect probably damaging
Transcript: ENSMUST00000182341
AA Change: Y321C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138193
Gene: ENSMUSG00000035189
AA Change: Y321C

DomainStartEndE-ValueType
Pfam:Anoctamin 339 922 4.8e-162 PFAM
low complexity region 932 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182462
Predicted Effect probably damaging
Transcript: ENSMUST00000182613
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138268
Gene: ENSMUSG00000035189
AA Change: Y286C

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182790
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138325
Gene: ENSMUSG00000035189
AA Change: Y286C

DomainStartEndE-ValueType
Pfam:Anoctamin 304 887 3.6e-162 PFAM
low complexity region 897 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182888
Meta Mutation Damage Score 0.3780 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Ano4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Ano4 APN 10 88954667 missense probably damaging 1.00
IGL00916:Ano4 APN 10 88998098 missense probably benign 0.01
IGL01010:Ano4 APN 10 88960600 missense probably benign 0.14
IGL01015:Ano4 APN 10 89035099 missense probably damaging 1.00
IGL01877:Ano4 APN 10 89025070 nonsense probably null 0.00
IGL02310:Ano4 APN 10 89023878 nonsense probably null
IGL02390:Ano4 APN 10 89024981 missense possibly damaging 0.88
IGL02560:Ano4 APN 10 88978741 nonsense probably null
Dwindle UTSW 10 88983778 missense probably damaging 0.98
P0017:Ano4 UTSW 10 88981190 nonsense probably null
PIT4486001:Ano4 UTSW 10 88993029 missense probably damaging 1.00
R0126:Ano4 UTSW 10 88952292 missense possibly damaging 0.73
R0380:Ano4 UTSW 10 88978813 missense possibly damaging 0.82
R0508:Ano4 UTSW 10 88980977 missense probably damaging 1.00
R0540:Ano4 UTSW 10 89023944 missense probably benign 0.00
R1802:Ano4 UTSW 10 88981016 missense probably damaging 1.00
R1864:Ano4 UTSW 10 88971391 missense probably damaging 1.00
R1871:Ano4 UTSW 10 88993027 missense probably damaging 1.00
R2829:Ano4 UTSW 10 89112939 missense possibly damaging 0.58
R2880:Ano4 UTSW 10 89112799 missense probably damaging 1.00
R3846:Ano4 UTSW 10 88995252 missense possibly damaging 0.93
R3904:Ano4 UTSW 10 89025005 missense probably damaging 1.00
R4006:Ano4 UTSW 10 89088263 missense probably benign 0.18
R4429:Ano4 UTSW 10 88992942 missense probably damaging 0.99
R4547:Ano4 UTSW 10 88981170 missense probably null
R4638:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4640:Ano4 UTSW 10 88954697 missense probably damaging 1.00
R4876:Ano4 UTSW 10 89112835 missense probably damaging 1.00
R5007:Ano4 UTSW 10 89112945 missense probably benign 0.26
R5104:Ano4 UTSW 10 89068112 missense possibly damaging 0.61
R5151:Ano4 UTSW 10 89112913 missense probably damaging 1.00
R5215:Ano4 UTSW 10 89317303 missense possibly damaging 0.86
R5396:Ano4 UTSW 10 89112840 missense probably damaging 1.00
R5826:Ano4 UTSW 10 88952327 missense probably damaging 1.00
R6018:Ano4 UTSW 10 89029266 missense probably benign 0.01
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6036:Ano4 UTSW 10 88982265 missense possibly damaging 0.95
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6037:Ano4 UTSW 10 89317246 missense possibly damaging 0.93
R6222:Ano4 UTSW 10 89027222 missense probably damaging 1.00
R6387:Ano4 UTSW 10 88971405 nonsense probably null
R6521:Ano4 UTSW 10 88983778 missense probably damaging 0.98
R6786:Ano4 UTSW 10 88992870 splice site probably null
R7035:Ano4 UTSW 10 88954711 missense probably damaging 1.00
R7523:Ano4 UTSW 10 88971395 nonsense probably null
R7715:Ano4 UTSW 10 88995311 missense probably damaging 0.99
R8005:Ano4 UTSW 10 88971321 missense probably benign 0.04
R8024:Ano4 UTSW 10 88971332 missense probably damaging 1.00
T0970:Ano4 UTSW 10 88981190 nonsense probably null
Z1176:Ano4 UTSW 10 89112945 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTGTCCCCTGAGAGGTTAG -3'
(R):5'- CCTTTCATAGAGAATGGGCCC -3'

Sequencing Primer
(F):5'- AGTTCCTCTTGGGGGAAAAGCC -3'
(R):5'- CATAGAGAATGGGCCCTTTCTAGC -3'
Posted On2018-08-01