Incidental Mutation 'R6739:Olfr1375'
ID530360
Institutional Source Beutler Lab
Gene Symbol Olfr1375
Ensembl Gene ENSMUSG00000057890
Gene Nameolfactory receptor 1375
SynonymsGA_x6K02T2QP88-4389999-4389056, MOR126-2, Olfr1375-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location51048109-51049050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 51048737 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 210 (V210E)
Ref Sequence ENSEMBL: ENSMUSP00000144756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073543]
Predicted Effect probably damaging
Transcript: ENSMUST00000073543
AA Change: V210E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073233
Gene: ENSMUSG00000057890
AA Change: V210E

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.4e-60 PFAM
Pfam:7TM_GPCR_Srsx 37 306 3.9e-6 PFAM
Pfam:7tm_1 43 291 9.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073543
AA Change: V210E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144756
Gene: ENSMUSG00000057890
AA Change: V210E

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 6.4e-60 PFAM
Pfam:7TM_GPCR_Srsx 37 306 3.9e-6 PFAM
Pfam:7tm_1 43 291 9.5e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Olfr1375
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Olfr1375 APN 11 51048400 missense probably benign 0.00
R0268:Olfr1375 UTSW 11 51048941 missense probably damaging 1.00
R0462:Olfr1375 UTSW 11 51048509 missense probably damaging 1.00
R0478:Olfr1375 UTSW 11 51048712 missense probably benign 0.03
R0839:Olfr1375 UTSW 11 51048427 missense probably benign 0.06
R2517:Olfr1375 UTSW 11 51048473 missense probably damaging 1.00
R4688:Olfr1375 UTSW 11 51048988 missense probably damaging 1.00
R4781:Olfr1375 UTSW 11 51048480 missense probably damaging 1.00
R5396:Olfr1375 UTSW 11 51048470 missense probably damaging 1.00
R6163:Olfr1375 UTSW 11 51048768 nonsense probably null
R7344:Olfr1375 UTSW 11 51048295 missense probably damaging 1.00
R7994:Olfr1375 UTSW 11 51048140 missense probably benign 0.31
R8054:Olfr1375 UTSW 11 51048263 missense probably benign 0.22
R8129:Olfr1375 UTSW 11 51048383 missense probably benign 0.00
R8940:Olfr1375 UTSW 11 51048628 missense probably benign 0.01
R9005:Olfr1375 UTSW 11 51048111 start codon destroyed probably null 0.18
R9008:Olfr1375 UTSW 11 51048111 start codon destroyed probably null 0.18
R9016:Olfr1375 UTSW 11 51048111 start codon destroyed probably null 0.18
R9018:Olfr1375 UTSW 11 51048111 start codon destroyed probably null 0.18
Z1176:Olfr1375 UTSW 11 51048835 missense probably damaging 1.00
Z1177:Olfr1375 UTSW 11 51048526 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATATGCTACCCACTACAG -3'
(R):5'- TGGCTACTGAGACCTGGATG -3'

Sequencing Primer
(F):5'- GTGTGGATGTGCTCTGCCC -3'
(R):5'- CCTGGATGGAGAAGGAGCCC -3'
Posted On2018-08-01