Incidental Mutation 'R6739:Il17rd'
ID530363
Institutional Source Beutler Lab
Gene Symbol Il17rd
Ensembl Gene ENSMUSG00000040717
Gene Nameinterleukin 17 receptor D
Synonyms2810004A10Rik, Sef, Sef-S
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location27038941-27107286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27099531 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 261 (R261G)
Ref Sequence ENSEMBL: ENSMUSP00000153140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035336] [ENSMUST00000225146] [ENSMUST00000226105]
Predicted Effect probably benign
Transcript: ENSMUST00000035336
AA Change: R405G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000036076
Gene: ENSMUSG00000040717
AA Change: R405G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:IL17R_D_N 48 169 2.7e-68 PFAM
Pfam:SEFIR 356 511 9.6e-56 PFAM
low complexity region 667 684 N/A INTRINSIC
low complexity region 688 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225146
AA Change: R261G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225829
Predicted Effect possibly damaging
Transcript: ENSMUST00000226105
AA Change: R261G

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein belonging to the interleukin-17 receptor (IL-17R) protein family. The encoded protein is a component of the interleukin-17 receptor signaling complex, and the interaction between this protein and IL-17R does not require the interleukin. The gene product also affects fibroblast growth factor signaling, inhibiting or stimulating growth through MAPK/ERK signaling. Alternate splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and show no obvious phenotype. A subset of mice homozygous for a gene-trapped allele display cochlear nucleus defects and abnormal auditory brainstem responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Il17rd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Il17rd APN 14 27095944 missense probably damaging 1.00
IGL02274:Il17rd APN 14 27099910 missense probably damaging 1.00
IGL02732:Il17rd APN 14 27087419 missense probably damaging 1.00
IGL03118:Il17rd APN 14 27093395 critical splice acceptor site probably null
IGL03175:Il17rd APN 14 27100006 missense probably damaging 1.00
FR4304:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4449:Il17rd UTSW 14 27082678 utr 5 prime probably benign
FR4737:Il17rd UTSW 14 27082680 utr 5 prime probably benign
FR4976:Il17rd UTSW 14 27082677 utr 5 prime probably benign
R0063:Il17rd UTSW 14 27082733 missense probably damaging 1.00
R0063:Il17rd UTSW 14 27082734 nonsense probably null
R0076:Il17rd UTSW 14 27094854 missense probably damaging 1.00
R0452:Il17rd UTSW 14 27091931 missense probably damaging 1.00
R1540:Il17rd UTSW 14 27099958 missense probably damaging 1.00
R1760:Il17rd UTSW 14 27091806 nonsense probably null
R2192:Il17rd UTSW 14 27094878 missense probably damaging 1.00
R2886:Il17rd UTSW 14 27099553 missense probably damaging 1.00
R3688:Il17rd UTSW 14 27039148 missense probably null 0.14
R4534:Il17rd UTSW 14 27096062 missense probably damaging 0.98
R5042:Il17rd UTSW 14 27096041 missense probably damaging 1.00
R5410:Il17rd UTSW 14 27095911 missense probably damaging 1.00
R5528:Il17rd UTSW 14 27088067 missense possibly damaging 0.94
R5829:Il17rd UTSW 14 27092085 splice site probably null
R5919:Il17rd UTSW 14 27096044 missense probably damaging 0.99
R6305:Il17rd UTSW 14 27095942 missense possibly damaging 0.77
R6829:Il17rd UTSW 14 27087422 nonsense probably null
R7301:Il17rd UTSW 14 27076391 missense possibly damaging 0.62
R7336:Il17rd UTSW 14 27087546 missense probably benign 0.00
R7521:Il17rd UTSW 14 27094866 missense probably benign 0.05
R7649:Il17rd UTSW 14 27039210 missense probably benign 0.22
R7741:Il17rd UTSW 14 27100336 missense probably damaging 1.00
R7814:Il17rd UTSW 14 27100117 missense probably benign 0.20
R8363:Il17rd UTSW 14 27091949 missense probably damaging 1.00
R8545:Il17rd UTSW 14 27091929 missense probably damaging 1.00
R8889:Il17rd UTSW 14 27099973 missense possibly damaging 0.93
Z1177:Il17rd UTSW 14 27100261 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TAGGGCCACAGTGCTAATGG -3'
(R):5'- AAGTAGACGGCGATGAACTTGC -3'

Sequencing Primer
(F):5'- GGCCCCCTGTGTTATCAAAATGATG -3'
(R):5'- GATGAACTTGCGCAGTGC -3'
Posted On2018-08-01