Incidental Mutation 'R6739:Krt75'
ID530367
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Namekeratin 75
SynonymsKrt2-6hf, 4732468K03Rik, K6hf, Krtcap1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101563345-101573904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101571068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 276 (D276N)
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042957]
Predicted Effect probably benign
Transcript: ENSMUST00000042957
AA Change: D276N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986
AA Change: D276N

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101572646 missense probably benign
IGL01406:Krt75 APN 15 101568025 missense probably damaging 1.00
IGL01783:Krt75 APN 15 101564929 missense probably benign 0.01
IGL01911:Krt75 APN 15 101568102 missense probably damaging 1.00
IGL01945:Krt75 APN 15 101570164 missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101572791 missense probably benign 0.00
IGL02832:Krt75 APN 15 101568073 missense probably benign 0.02
IGL03173:Krt75 APN 15 101572727 missense probably damaging 1.00
IGL03276:Krt75 APN 15 101568376 missense probably damaging 0.98
BB007:Krt75 UTSW 15 101564883 makesense probably null
BB017:Krt75 UTSW 15 101564883 makesense probably null
R0482:Krt75 UTSW 15 101570311 missense probably benign 0.22
R0595:Krt75 UTSW 15 101568354 missense probably damaging 1.00
R0626:Krt75 UTSW 15 101573590 missense probably benign 0.05
R1495:Krt75 UTSW 15 101573873 start gained probably benign
R1886:Krt75 UTSW 15 101571097 missense probably damaging 0.97
R1906:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101572761 missense probably benign 0.08
R2504:Krt75 UTSW 15 101568031 missense probably benign 0.27
R2930:Krt75 UTSW 15 101568031 missense probably benign 0.27
R3788:Krt75 UTSW 15 101573521 missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101571701 nonsense probably null
R4803:Krt75 UTSW 15 101568072 missense probably benign 0.00
R4868:Krt75 UTSW 15 101568121 missense probably damaging 1.00
R4906:Krt75 UTSW 15 101570239 missense probably damaging 1.00
R4969:Krt75 UTSW 15 101573813 missense probably benign
R5069:Krt75 UTSW 15 101566238 critical splice donor site probably null
R5446:Krt75 UTSW 15 101571067 missense probably null 0.22
R6019:Krt75 UTSW 15 101573723 missense probably benign 0.00
R6835:Krt75 UTSW 15 101571037 missense probably benign 0.16
R7167:Krt75 UTSW 15 101568315 missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101570272 missense probably damaging 1.00
R7930:Krt75 UTSW 15 101564883 makesense probably null
R8046:Krt75 UTSW 15 101572764 missense probably benign 0.01
R8943:Krt75 UTSW 15 101568332 missense probably benign 0.03
X0022:Krt75 UTSW 15 101570213 missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101573665 missense probably benign 0.00
Z1177:Krt75 UTSW 15 101571054 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAATCAAAGTTCCCAGCATTCC -3'
(R):5'- CTCAGGGTTCTGTTAGTCCATG -3'

Sequencing Primer
(F):5'- AAAGTTCCCAGCATTCCTCTCCAG -3'
(R):5'- TAGTCCATGAAGCTTAAGCCCTGG -3'
Posted On2018-08-01