Incidental Mutation 'R6739:Lox'
ID530370
Institutional Source Beutler Lab
Gene Symbol Lox
Ensembl Gene ENSMUSG00000024529
Gene Namelysyl oxidase
SynonymsTSC-160, ras recision gene (rrg)
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location52516069-52529867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52526959 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 268 (T268A)
Ref Sequence ENSEMBL: ENSMUSP00000129247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025409] [ENSMUST00000171470]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025409
AA Change: T268A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025409
Gene: ENSMUSG00000024529
AA Change: T268A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 411 2.3e-121 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171470
AA Change: T268A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129247
Gene: ENSMUSG00000024529
AA Change: T268A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 408 3.7e-96 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a precursor protein that belongs to the lysyl oxidase family of proteins. The secreted proprotein is proteolytically processed to an active mature peptide and a propeptide. This propeptide is thought to function in tumor suppression by inhibiting the Ras signaling pathway. The active enzyme plays a role in cross-linking of collagen and elastin and is essential for development of cardiovascular and respiratory systems, and development of skin and connective tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to altered arterial wall structure, aortic aneurysms, cardiovascular dysfunction, diaphragmatic hernia, and perinatal death. Abnormal development of the respiratory system, and elastic and collagen fiber abnormalities in the lung and skin are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik C T 19: 7,421,347 R243* probably null Het
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in Lox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lox APN 18 52520854 missense possibly damaging 0.74
IGL02457:Lox APN 18 52521316 missense probably damaging 1.00
IGL02665:Lox APN 18 52525244 splice site probably benign
R0040:Lox UTSW 18 52520826 missense possibly damaging 0.91
R0383:Lox UTSW 18 52529199 missense possibly damaging 0.50
R0658:Lox UTSW 18 52528883 missense probably benign 0.00
R1391:Lox UTSW 18 52528819 missense probably damaging 0.99
R1721:Lox UTSW 18 52520911 critical splice acceptor site probably null
R1794:Lox UTSW 18 52528307 missense probably damaging 1.00
R3122:Lox UTSW 18 52525105 missense probably damaging 0.97
R5436:Lox UTSW 18 52529103 missense probably benign
R5679:Lox UTSW 18 52528917 missense probably benign 0.00
R7679:Lox UTSW 18 52525106 missense possibly damaging 0.80
R7840:Lox UTSW 18 52525122 nonsense probably null
R8015:Lox UTSW 18 52528348 missense probably benign 0.27
Z1176:Lox UTSW 18 52520834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGGCACCAAACTGCATAGG -3'
(R):5'- ACAGGAACTCATGATCCCTTG -3'

Sequencing Primer
(F):5'- GCACCAAACTGCATAGGAAAAGTTC -3'
(R):5'- AACTCATGATCCCTTGAGCGGAG -3'
Posted On2018-08-01