Mutagenetix > Incidental Mutation

Incidental Mutation 'R6739:Pitpnm1'

530371

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm1

Ensembl Gene

ENSMUSG00000024851

Gene Name

phosphatidylinositol transfer protein, membrane-associated 1

Synonyms

DRES9, RdgB

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6739 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4099998-4113965 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 4110522 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 781 (L781H)

Ref Sequence

ENSEMBL: ENSMUSP00000097599 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025767] [ENSMUST00000049658] [ENSMUST00000100022] [ENSMUST00000117831] [ENSMUST00000121402]

AlphaFold

O35954

Predicted Effect

probably benign
Transcript: ENSMUST00000025767

SMART Domains

Protein: ENSMUSP00000025767
Gene: ENSMUSG00000024847

Domain	Start	End	E-Value	Type
Pfam:FKBP_C	26	155	5.3e-11	PFAM
PDB:4APO\|B	166	330	1e-113	PDB
SCOP:d1ihga1	170	322	1e-14	SMART
Blast:TPR	231	264	3e-7	BLAST
Blast:TPR	265	298	7e-7	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000049658
AA Change: L781H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054309
Gene: ENSMUSG00000024851
AA Change: L781H

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	252	2e-145	PFAM
low complexity region	284	304	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
low complexity region	342	349	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	557	571	N/A	INTRINSIC
low complexity region	578	593	N/A	INTRINSIC
DDHD	685	879	5.94e-86	SMART
Blast:DDHD	880	963	2e-42	BLAST
LNS2	1022	1153	1.35e-57	SMART
low complexity region	1184	1195	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000100022
AA Change: L781H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097599
Gene: ENSMUSG00000024851
AA Change: L781H

Domain	Start	End	E-Value	Type
Pfam:IP_trans	1	250	1.6e-113	PFAM
low complexity region	284	304	N/A	INTRINSIC
low complexity region	310	319	N/A	INTRINSIC
low complexity region	342	349	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	557	571	N/A	INTRINSIC
low complexity region	578	593	N/A	INTRINSIC
DDHD	685	879	5.94e-86	SMART
Blast:DDHD	880	963	2e-42	BLAST
LNS2	1022	1153	1.35e-57	SMART
low complexity region	1184	1195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000117831

SMART Domains

Protein: ENSMUSP00000113807
Gene: ENSMUSG00000024847

Domain	Start	End	E-Value	Type
Pfam:FKBP_C	26	155	1e-10	PFAM
PDB:4APO\|B	166	330	1e-113	PDB
SCOP:d1ihga1	170	322	1e-14	SMART
Blast:TPR	231	264	3e-7	BLAST
Blast:TPR	265	298	7e-7	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000121402

SMART Domains

Protein: ENSMUSP00000114096
Gene: ENSMUSG00000024847

Domain	Start	End	E-Value	Type
Pfam:FKBP_C	26	155	1.5e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125596

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126620

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127056

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128798

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145915

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151957

Meta Mutation Damage Score

0.3279

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 96.0%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM1 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male-specific decrease in circulating cholesterol and circulating calcium levels and female-specific decreased leukocyte cell numbers and a slight increase in auditory brainstem response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	C	T	19: 7,421,347	R243*	probably null	Het
Adcy9	A	G	16: 4,418,794	V14A	probably benign	Het
Ank2	A	T	3: 127,079,994	N59K	probably damaging	Het
Ano4	T	C	10: 89,027,252	Y286C	probably damaging	Het
Arhgap21	G	A	2: 20,880,732	H545Y	possibly damaging	Het
Arid1a	T	A	4: 133,687,626	S1152C	unknown	Het
Cfap73	T	C	5: 120,630,193	T167A	probably benign	Het
Ctbs	A	T	3: 146,459,499		probably null	Het
Dmgdh	T	A	13: 93,720,615	N742K	probably benign	Het
Dmxl1	T	C	18: 49,878,246	S1157P	probably benign	Het
Dnm3	T	C	1: 162,477,783	N14S	probably damaging	Het
Dpp4	C	T	2: 62,387,095	V53I	probably benign	Het
Etl4	A	G	2: 20,713,435	N329S	probably damaging	Het
Fbxw25	A	G	9: 109,651,631	V327A	probably benign	Het
Gsg1	T	A	6: 135,237,614	Q299L	probably damaging	Het
Igsf23	A	G	7: 19,944,748	L39P	probably damaging	Het
Il17rd	A	G	14: 27,099,531	R261G	possibly damaging	Het
Krt75	C	T	15: 101,571,068	D276N	probably benign	Het
Lox	T	C	18: 52,526,959	T268A	possibly damaging	Het
Mroh4	T	C	15: 74,609,719	S825G	probably benign	Het
Nlrp9c	T	C	7: 26,385,425	D243G	probably damaging	Het
Olfr1375	T	A	11: 51,048,737	V210E	probably damaging	Het
Olfr713	T	C	7: 107,036,811	Y219H	probably damaging	Het
Picalm	C	A	7: 90,176,708	T131N	probably damaging	Het
Proz	A	T	8: 13,073,451	I241F	possibly damaging	Het
Rb1cc1	A	G	1: 6,234,230	D67G	probably damaging	Het
Rnf213	T	A	11: 119,442,271	C2769S	probably damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Scn8a	T	C	15: 101,015,955	I1076T	possibly damaging	Het
Snrnp70	A	T	7: 45,387,419	D100E	probably damaging	Het
Triobp	T	A	15: 78,966,366	L240Q	possibly damaging	Het
Vmn2r5	A	G	3: 64,491,216	S781P	probably damaging	Het
Zfp451	A	G	1: 33,803,594		probably benign	Het

Other mutations in Pitpnm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00886:Pitpnm1	APN	19	4110665	splice site	probably null
IGL00978:Pitpnm1	APN	19	4101228	missense	possibly damaging	0.61
IGL02039:Pitpnm1	APN	19	4105032	missense	probably benign	0.01
IGL02122:Pitpnm1	APN	19	4107796	missense	probably damaging	1.00
IGL02279:Pitpnm1	APN	19	4101207	missense	probably damaging	1.00
IGL02316:Pitpnm1	APN	19	4112835	missense	probably benign	0.16
IGL02434:Pitpnm1	APN	19	4103377	missense	probably benign	0.00
R0926:Pitpnm1	UTSW	19	4112338	missense	probably damaging	1.00
R1301:Pitpnm1	UTSW	19	4110831	splice site	probably null
R1423:Pitpnm1	UTSW	19	4112392	missense	probably damaging	1.00
R1592:Pitpnm1	UTSW	19	4106964	critical splice donor site	probably null
R1733:Pitpnm1	UTSW	19	4109960	nonsense	probably null
R1844:Pitpnm1	UTSW	19	4112395	missense	probably damaging	1.00
R1971:Pitpnm1	UTSW	19	4112450	missense	probably damaging	1.00
R1978:Pitpnm1	UTSW	19	4107973	splice site	probably null
R2016:Pitpnm1	UTSW	19	4111873	missense	probably benign	0.25
R2017:Pitpnm1	UTSW	19	4111873	missense	probably benign	0.25
R2019:Pitpnm1	UTSW	19	4113641	missense	probably damaging	1.00
R2210:Pitpnm1	UTSW	19	4105253	missense	probably damaging	1.00
R2393:Pitpnm1	UTSW	19	4110935	missense	probably benign	0.02
R3434:Pitpnm1	UTSW	19	4112234	missense	probably damaging	1.00
R3439:Pitpnm1	UTSW	19	4112752	missense	probably benign	0.00
R4554:Pitpnm1	UTSW	19	4103085	missense	probably benign	0.16
R4555:Pitpnm1	UTSW	19	4103085	missense	probably benign	0.16
R4557:Pitpnm1	UTSW	19	4103085	missense	probably benign	0.16
R4831:Pitpnm1	UTSW	19	4108130	missense	probably damaging	1.00
R4874:Pitpnm1	UTSW	19	4112252	critical splice donor site	probably null
R5058:Pitpnm1	UTSW	19	4112758	missense	probably benign	0.00
R5069:Pitpnm1	UTSW	19	4111140	missense	probably benign	0.44
R5249:Pitpnm1	UTSW	19	4108130	missense	probably damaging	1.00
R5288:Pitpnm1	UTSW	19	4103435	missense	probably damaging	0.99
R5385:Pitpnm1	UTSW	19	4103435	missense	probably damaging	0.99
R5619:Pitpnm1	UTSW	19	4103270	missense	probably damaging	1.00
R5650:Pitpnm1	UTSW	19	4103319	missense	possibly damaging	0.78
R6267:Pitpnm1	UTSW	19	4110522	missense	probably damaging	1.00
R6341:Pitpnm1	UTSW	19	4102829	nonsense	probably null
R6608:Pitpnm1	UTSW	19	4110875	missense	probably damaging	1.00
R6915:Pitpnm1	UTSW	19	4106947	missense	possibly damaging	0.95
R7141:Pitpnm1	UTSW	19	4102787	missense	probably damaging	0.97
R7751:Pitpnm1	UTSW	19	4103470	missense	probably benign	0.02
R8057:Pitpnm1	UTSW	19	4112145	missense	probably null	0.71
R8210:Pitpnm1	UTSW	19	4112878	critical splice donor site	probably null
R8415:Pitpnm1	UTSW	19	4105454	missense	probably benign	0.37
R8462:Pitpnm1	UTSW	19	4105135	missense	probably benign	0.03
R8808:Pitpnm1	UTSW	19	4112356	missense	possibly damaging	0.94
R9060:Pitpnm1	UTSW	19	4106869	missense	probably damaging	0.96
R9646:Pitpnm1	UTSW	19	4103269	missense	probably damaging	1.00
R9766:Pitpnm1	UTSW	19	4108117	missense	probably benign	0.10
Z1177:Pitpnm1	UTSW	19	4105009	missense	probably benign
Z1177:Pitpnm1	UTSW	19	4109996	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGTCTCTGCCCTGGAAGTC -3'
(R):5'- TCCATCTACCTAGGACAATGTGTG -3'

Sequencing Primer
(F):5'- GGAAGTCTTCAGCTTCAGCC -3'
(R):5'- CTTATGAAGTGATACGCTTCCAGGC -3'

Posted On

2018-08-01