Incidental Mutation 'R6739:2700081O15Rik'
ID530372
Institutional Source Beutler Lab
Gene Symbol 2700081O15Rik
Ensembl Gene ENSMUSG00000053080
Gene NameRIKEN cDNA 2700081O15 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R6739 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location7417625-7425904 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 7421347 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 243 (R243*)
Ref Sequence ENSEMBL: ENSMUSP00000123773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088171] [ENSMUST00000159348] [ENSMUST00000161907]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065304
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159346
AA Change: R79*
SMART Domains Protein: ENSMUSP00000124442
Gene: ENSMUSG00000053080
AA Change: R79*

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
low complexity region 42 67 N/A INTRINSIC
low complexity region 72 97 N/A INTRINSIC
low complexity region 178 215 N/A INTRINSIC
ZnF_C2H2 231 256 2.06e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000159348
AA Change: R243*
SMART Domains Protein: ENSMUSP00000123773
Gene: ENSMUSG00000053080
AA Change: R243*

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
ZnF_C2H2 124 149 3.38e1 SMART
low complexity region 171 201 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 235 260 N/A INTRINSIC
ZnF_C2H2 283 308 1.06e2 SMART
low complexity region 382 419 N/A INTRINSIC
ZnF_C2H2 435 460 2.06e1 SMART
low complexity region 491 522 N/A INTRINSIC
low complexity region 540 547 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
ZnF_C2H2 600 625 2.54e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160561
SMART Domains Protein: ENSMUSP00000124645
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
ZnF_C2H2 10 35 1.06e2 SMART
low complexity region 109 146 N/A INTRINSIC
ZnF_C2H2 162 187 2.06e1 SMART
low complexity region 218 249 N/A INTRINSIC
low complexity region 267 274 N/A INTRINSIC
low complexity region 284 299 N/A INTRINSIC
ZnF_C2H2 327 352 2.54e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161907
SMART Domains Protein: ENSMUSP00000139847
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
ZnF_C2H2 70 95 1.4e-1 SMART
coiled coil region 124 151 N/A INTRINSIC
low complexity region 173 180 N/A INTRINSIC
low complexity region 190 205 N/A INTRINSIC
ZnF_C2H2 233 258 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183837
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189779
Predicted Effect probably benign
Transcript: ENSMUST00000191580
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.0%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 A G 16: 4,418,794 V14A probably benign Het
Ank2 A T 3: 127,079,994 N59K probably damaging Het
Ano4 T C 10: 89,027,252 Y286C probably damaging Het
Arhgap21 G A 2: 20,880,732 H545Y possibly damaging Het
Arid1a T A 4: 133,687,626 S1152C unknown Het
Cfap73 T C 5: 120,630,193 T167A probably benign Het
Ctbs A T 3: 146,459,499 probably null Het
Dmgdh T A 13: 93,720,615 N742K probably benign Het
Dmxl1 T C 18: 49,878,246 S1157P probably benign Het
Dnm3 T C 1: 162,477,783 N14S probably damaging Het
Dpp4 C T 2: 62,387,095 V53I probably benign Het
Etl4 A G 2: 20,713,435 N329S probably damaging Het
Fbxw25 A G 9: 109,651,631 V327A probably benign Het
Gsg1 T A 6: 135,237,614 Q299L probably damaging Het
Igsf23 A G 7: 19,944,748 L39P probably damaging Het
Il17rd A G 14: 27,099,531 R261G possibly damaging Het
Krt75 C T 15: 101,571,068 D276N probably benign Het
Lox T C 18: 52,526,959 T268A possibly damaging Het
Mroh4 T C 15: 74,609,719 S825G probably benign Het
Nlrp9c T C 7: 26,385,425 D243G probably damaging Het
Olfr1375 T A 11: 51,048,737 V210E probably damaging Het
Olfr713 T C 7: 107,036,811 Y219H probably damaging Het
Picalm C A 7: 90,176,708 T131N probably damaging Het
Pitpnm1 T A 19: 4,110,522 L781H probably damaging Het
Proz A T 8: 13,073,451 I241F possibly damaging Het
Rb1cc1 A G 1: 6,234,230 D67G probably damaging Het
Rnf213 T A 11: 119,442,271 C2769S probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Scn8a T C 15: 101,015,955 I1076T possibly damaging Het
Snrnp70 A T 7: 45,387,419 D100E probably damaging Het
Triobp T A 15: 78,966,366 L240Q possibly damaging Het
Vmn2r5 A G 3: 64,491,216 S781P probably damaging Het
Zfp451 A G 1: 33,803,594 probably benign Het
Other mutations in 2700081O15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:2700081O15Rik APN 19 7422376 missense probably damaging 1.00
IGL02814:2700081O15Rik APN 19 7420422 missense possibly damaging 0.94
H8562:2700081O15Rik UTSW 19 7422921 missense probably benign 0.01
R0034:2700081O15Rik UTSW 19 7420359 missense probably damaging 1.00
R0583:2700081O15Rik UTSW 19 7420274 missense probably damaging 1.00
R2351:2700081O15Rik UTSW 19 7422244 missense probably damaging 1.00
R4326:2700081O15Rik UTSW 19 7421226 intron probably benign
R4329:2700081O15Rik UTSW 19 7421226 intron probably benign
R5474:2700081O15Rik UTSW 19 7420159 missense probably damaging 1.00
R5735:2700081O15Rik UTSW 19 7422796 missense probably benign
R6168:2700081O15Rik UTSW 19 7422940 missense probably benign 0.40
R7780:2700081O15Rik UTSW 19 7422372 missense probably damaging 0.96
R7855:2700081O15Rik UTSW 19 7422256 missense probably damaging 1.00
R8550:2700081O15Rik UTSW 19 7422955 missense probably benign 0.00
Z1176:2700081O15Rik UTSW 19 7422747 missense unknown
Predicted Primers PCR Primer
(F):5'- GACCTGAGTCAGTTGAGTGAG -3'
(R):5'- CTGCCGCCCTAATATTGAAGG -3'

Sequencing Primer
(F):5'- TCAGTTGAGTGAGAAAGAGACTGTG -3'
(R):5'- CCTAATATTGAAGGGATCTCAGCC -3'
Posted On2018-08-01