Incidental Mutation 'R6690:Olfr370'
ID530383
Institutional Source Beutler Lab
Gene Symbol Olfr370
Ensembl Gene ENSMUSG00000047286
Gene Nameolfactory receptor 370
SynonymsGA_x6K02T2NUPS-11609807-11610751, MOR267-16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6690 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83535780-83545227 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 83541275 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 44 (V44L)
Ref Sequence ENSEMBL: ENSMUSP00000149251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058609] [ENSMUST00000209408] [ENSMUST00000214156]
Predicted Effect probably benign
Transcript: ENSMUST00000058609
AA Change: V44L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055435
Gene: ENSMUSG00000047286
AA Change: V44L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-44 PFAM
Pfam:7tm_1 41 290 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209408
AA Change: V44L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000214156
AA Change: V44L

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,284,718 G628D probably damaging Het
Ahnak G T 19: 9,009,581 G2743V probably benign Het
Akr1c14 A T 13: 4,063,713 T82S possibly damaging Het
Ccdc7b A G 8: 129,178,219 T113A probably benign Het
Cep152 A T 2: 125,564,370 L1414Q probably damaging Het
Chd8 T C 14: 52,227,237 E658G possibly damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Coro6 A G 11: 77,465,780 T105A probably benign Het
Cux1 A G 5: 136,340,117 I232T probably damaging Het
Dmrt1 A G 19: 25,546,085 T267A probably benign Het
Fam149a G T 8: 45,349,034 A387E probably damaging Het
Fat4 G A 3: 38,983,539 G3780D probably damaging Het
Igf2r A T 17: 12,691,937 L1998* probably null Het
Iqcf6 C T 9: 106,627,302 T55I possibly damaging Het
Mterf3 G A 13: 66,917,046 L264F probably damaging Het
Olfr951 A G 9: 39,394,549 I253V probably benign Het
Pcdhgb7 A T 18: 37,752,997 I407F probably benign Het
Pip4k2b T C 11: 97,729,567 D114G probably damaging Het
Plbd1 G T 6: 136,635,600 N198K probably damaging Het
Prkcb T C 7: 122,289,514 I57T probably damaging Het
Ralgapa1 C T 12: 55,722,773 probably null Het
Slc26a8 A G 17: 28,644,655 I710T possibly damaging Het
Smc2 A T 4: 52,449,375 I179L probably benign Het
Tmub2 C T 11: 102,287,519 H83Y probably damaging Het
Trip11 C A 12: 101,885,451 D785Y possibly damaging Het
Vill A G 9: 119,061,907 T194A probably benign Het
Vmn2r59 T C 7: 42,046,466 D174G probably damaging Het
Other mutations in Olfr370
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr370 APN 8 83541618 missense probably benign 0.00
IGL02481:Olfr370 APN 8 83541386 missense possibly damaging 0.70
IGL02499:Olfr370 APN 8 83541183 missense possibly damaging 0.83
IGL02832:Olfr370 APN 8 83541471 missense probably damaging 1.00
R0315:Olfr370 UTSW 8 83541372 missense possibly damaging 0.90
R0330:Olfr370 UTSW 8 83541513 missense probably damaging 1.00
R1737:Olfr370 UTSW 8 83541416 missense probably benign 0.05
R1973:Olfr370 UTSW 8 83541792 missense probably benign 0.00
R2157:Olfr370 UTSW 8 83541621 missense probably benign 0.00
R4687:Olfr370 UTSW 8 83541860 missense probably damaging 1.00
R5639:Olfr370 UTSW 8 83541344 missense probably damaging 1.00
R6150:Olfr370 UTSW 8 83541153 missense probably benign 0.02
R6590:Olfr370 UTSW 8 83541275 missense probably benign 0.08
R6682:Olfr370 UTSW 8 83541558 missense probably benign 0.00
R7846:Olfr370 UTSW 8 83541897 missense probably damaging 1.00
R7886:Olfr370 UTSW 8 83541947 missense possibly damaging 0.95
R7929:Olfr370 UTSW 8 83541897 missense probably damaging 1.00
R7969:Olfr370 UTSW 8 83541947 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACGGCTGTCAATCTCCTGTG -3'
(R):5'- GTGAACATTTGGATGGCGC -3'

Sequencing Primer
(F):5'- CTTCTCGAGTGTGTAAGGATTTCC -3'
(R):5'- CAGCCGAGGAAAGAGATGCTC -3'
Posted On2018-08-01