Incidental Mutation 'R6690:Iqcf6'
ID530386
Institutional Source Beutler Lab
Gene Symbol Iqcf6
Ensembl Gene ENSMUSG00000091129
Gene NameIQ motif containing F6
Synonyms100041096
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R6690 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location106626582-106627675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106627302 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 55 (T55I)
Ref Sequence ENSEMBL: ENSMUSP00000131823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000171091
AA Change: T55I

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131823
Gene: ENSMUSG00000091129
AA Change: T55I

DomainStartEndE-ValueType
IQ 35 57 2.06e-3 SMART
IQ 91 113 8.13e-2 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,284,718 G628D probably damaging Het
Ahnak G T 19: 9,009,581 G2743V probably benign Het
Akr1c14 A T 13: 4,063,713 T82S possibly damaging Het
Ccdc7b A G 8: 129,178,219 T113A probably benign Het
Cep152 A T 2: 125,564,370 L1414Q probably damaging Het
Chd8 T C 14: 52,227,237 E658G possibly damaging Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Coro6 A G 11: 77,465,780 T105A probably benign Het
Cux1 A G 5: 136,340,117 I232T probably damaging Het
Dmrt1 A G 19: 25,546,085 T267A probably benign Het
Fam149a G T 8: 45,349,034 A387E probably damaging Het
Fat4 G A 3: 38,983,539 G3780D probably damaging Het
Igf2r A T 17: 12,691,937 L1998* probably null Het
Mterf3 G A 13: 66,917,046 L264F probably damaging Het
Olfr370 G T 8: 83,541,275 V44L probably benign Het
Olfr951 A G 9: 39,394,549 I253V probably benign Het
Pcdhgb7 A T 18: 37,752,997 I407F probably benign Het
Pip4k2b T C 11: 97,729,567 D114G probably damaging Het
Plbd1 G T 6: 136,635,600 N198K probably damaging Het
Prkcb T C 7: 122,289,514 I57T probably damaging Het
Ralgapa1 C T 12: 55,722,773 probably null Het
Slc26a8 A G 17: 28,644,655 I710T possibly damaging Het
Smc2 A T 4: 52,449,375 I179L probably benign Het
Tmub2 C T 11: 102,287,519 H83Y probably damaging Het
Trip11 C A 12: 101,885,451 D785Y possibly damaging Het
Vill A G 9: 119,061,907 T194A probably benign Het
Vmn2r59 T C 7: 42,046,466 D174G probably damaging Het
Other mutations in Iqcf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Iqcf6 APN 9 106627508 missense probably benign
IGL02006:Iqcf6 APN 9 106627311 missense probably benign 0.13
IGL02519:Iqcf6 APN 9 106627280 missense probably damaging 1.00
R0925:Iqcf6 UTSW 9 106627301 missense probably benign 0.00
R1493:Iqcf6 UTSW 9 106627442 missense probably benign 0.00
R4686:Iqcf6 UTSW 9 106627344 missense probably damaging 1.00
R6590:Iqcf6 UTSW 9 106627302 missense possibly damaging 0.83
R7489:Iqcf6 UTSW 9 106627457 missense probably benign 0.25
R8847:Iqcf6 UTSW 9 106627451 missense probably damaging 1.00
R8867:Iqcf6 UTSW 9 106627499 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACAAGAGGTCAGGACAGCCC -3'
(R):5'- TACCTTGGCTTTGGCTAGCATG -3'

Sequencing Primer
(F):5'- TCAGGACAGCCCAGGACAG -3'
(R):5'- AGTCTGGATAATGCAGGCTGC -3'
Posted On2018-08-01