Mutagenetix > Incidental Mutations

Incidental Mutation 'R6690:Trip11'

530392

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6690 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 101885451 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 785 (D785Y)

Ref Sequence

ENSEMBL: ENSMUSP00000021605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000176728] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021605
AA Change: D785Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: D785Y

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176728

SMART Domains

Protein: ENSMUSP00000134992
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
Pfam:Orthopox_A5L	48	282	6.5e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177183
AA Change: D500Y

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: D500Y

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,284,718	G628D	probably damaging	Het
Ahnak	G	T	19: 9,009,581	G2743V	probably benign	Het
Akr1c14	A	T	13: 4,063,713	T82S	possibly damaging	Het
Ccdc7b	A	G	8: 129,178,219	T113A	probably benign	Het
Cep152	A	T	2: 125,564,370	L1414Q	probably damaging	Het
Chd8	T	C	14: 52,227,237	E658G	possibly damaging	Het
Clca1	G	C	3: 145,013,883	A442G	probably damaging	Het
Coro6	A	G	11: 77,465,780	T105A	probably benign	Het
Cux1	A	G	5: 136,340,117	I232T	probably damaging	Het
Dmrt1	A	G	19: 25,546,085	T267A	probably benign	Het
Fam149a	G	T	8: 45,349,034	A387E	probably damaging	Het
Fat4	G	A	3: 38,983,539	G3780D	probably damaging	Het
Igf2r	A	T	17: 12,691,937	L1998*	probably null	Het
Iqcf6	C	T	9: 106,627,302	T55I	possibly damaging	Het
Mterf3	G	A	13: 66,917,046	L264F	probably damaging	Het
Olfr370	G	T	8: 83,541,275	V44L	probably benign	Het
Olfr951	A	G	9: 39,394,549	I253V	probably benign	Het
Pcdhgb7	A	T	18: 37,752,997	I407F	probably benign	Het
Pip4k2b	T	C	11: 97,729,567	D114G	probably damaging	Het
Plbd1	G	T	6: 136,635,600	N198K	probably damaging	Het
Prkcb	T	C	7: 122,289,514	I57T	probably damaging	Het
Ralgapa1	C	T	12: 55,722,773		probably null	Het
Slc26a8	A	G	17: 28,644,655	I710T	possibly damaging	Het
Smc2	A	T	4: 52,449,375	I179L	probably benign	Het
Tmub2	C	T	11: 102,287,519	H83Y	probably damaging	Het
Vill	A	G	9: 119,061,907	T194A	probably benign	Het
Vmn2r59	T	C	7: 42,046,466	D174G	probably damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	splice site	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101884070	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101844855	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101837665	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101883482	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101894384	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101844901	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101912804	missense	unknown
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCATGGATCCAAGACTTCTATCC -3'
(R):5'- CTGTGTCGAGCTGAAAAGCG -3'

Sequencing Primer
(F):5'- TCTATGGTCTGCCTTAAAGTCTC -3'
(R):5'- CGAGCTGAAAAGCGGGTGTTG -3'

Posted On

2018-08-01