Incidental Mutation 'R6691:Olfr1055'
ID530403
Institutional Source Beutler Lab
Gene Symbol Olfr1055
Ensembl Gene ENSMUSG00000075189
Gene Nameolfactory receptor 1055
SynonymsMOR186-1, GA_x6K02T2Q125-47819205-47818258
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86346624-86350284 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86347419 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 116 (S116A)
Ref Sequence ENSEMBL: ENSMUSP00000140847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099894] [ENSMUST00000188023] [ENSMUST00000213564]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099894
AA Change: S116A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097479
Gene: ENSMUSG00000075189
AA Change: S116A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.3e-49 PFAM
Pfam:7tm_1 41 290 1.3e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000188023
AA Change: S116A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140847
Gene: ENSMUSG00000075189
AA Change: S116A

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 5.7e-30 PFAM
Pfam:7tm_4 139 283 9.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213564
AA Change: S116A

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Olfr1055
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1055 APN 2 86347733 missense possibly damaging 0.71
IGL02524:Olfr1055 APN 2 86347342 missense probably damaging 1.00
R0123:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0134:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R0225:Olfr1055 UTSW 2 86347728 missense possibly damaging 0.46
R1981:Olfr1055 UTSW 2 86347142 missense possibly damaging 0.94
R4181:Olfr1055 UTSW 2 86347237 missense probably damaging 1.00
R5011:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5013:Olfr1055 UTSW 2 86347303 missense probably benign 0.00
R5077:Olfr1055 UTSW 2 86347339 missense probably benign 0.00
R6312:Olfr1055 UTSW 2 86347581 missense probably damaging 1.00
R6345:Olfr1055 UTSW 2 86347548 missense probably damaging 1.00
R6591:Olfr1055 UTSW 2 86347419 missense probably damaging 1.00
R6626:Olfr1055 UTSW 2 86347020 missense possibly damaging 0.81
R6680:Olfr1055 UTSW 2 86347245 missense probably damaging 1.00
R7447:Olfr1055 UTSW 2 86346806 missense possibly damaging 0.86
R7622:Olfr1055 UTSW 2 86347662 missense possibly damaging 0.61
R8114:Olfr1055 UTSW 2 86347186 missense probably benign 0.00
R8138:Olfr1055 UTSW 2 86347586 missense possibly damaging 0.81
Z1176:Olfr1055 UTSW 2 86346883 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AACGGCAGACTGTCACAGTAG -3'
(R):5'- ATAGACTCTAGACTTCAGACACCTATG -3'

Sequencing Primer
(F):5'- CTGTCACAGTAGAAATGCCTGATG -3'
(R):5'- AGACTTCAGACACCTATGTACTTC -3'
Posted On2018-08-01