Incidental Mutation 'R6691:Agk'
ID530411
Institutional Source Beutler Lab
Gene Symbol Agk
Ensembl Gene ENSMUSG00000029916
Gene Nameacylglycerol kinase
SynonymsMuLK, 2610037M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.613) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40325172-40396762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40392690 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 337 (D337G)
Ref Sequence ENSEMBL: ENSMUSP00000031977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031977]
Predicted Effect probably benign
Transcript: ENSMUST00000031977
AA Change: D337G

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031977
Gene: ENSMUSG00000029916
AA Change: D337G

DomainStartEndE-ValueType
DAGKc 62 193 1.9e-6 SMART
low complexity region 257 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201751
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mitochondrial membrane protein involved in lipid and glycerolipid metabolism. The encoded protein is a lipid kinase that catalyzes the formation of phosphatidic and lysophosphatidic acids. Defects in this gene have been associated with mitochondrial DNA depletion syndrome 10. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Kcnk1 T C 8: 126,025,231 V192A probably benign Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Agk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Agk APN 6 40376226 missense probably damaging 0.98
IGL02254:Agk APN 6 40381246 missense probably damaging 1.00
IGL02309:Agk APN 6 40376276 missense possibly damaging 0.59
IGL03371:Agk APN 6 40394642 missense probably benign
R1145:Agk UTSW 6 40352438 splice site probably benign
R1470:Agk UTSW 6 40386817 missense probably damaging 1.00
R1470:Agk UTSW 6 40386817 missense probably damaging 1.00
R1806:Agk UTSW 6 40387495 missense probably damaging 0.99
R2011:Agk UTSW 6 40376234 missense probably benign 0.00
R3552:Agk UTSW 6 40394681 missense probably benign
R4853:Agk UTSW 6 40383819 critical splice donor site probably null
R6367:Agk UTSW 6 40386941 missense probably benign 0.01
R6591:Agk UTSW 6 40392690 missense probably benign 0.29
R6753:Agk UTSW 6 40368570 splice site probably null
R7299:Agk UTSW 6 40329517 missense possibly damaging 0.93
R7301:Agk UTSW 6 40329517 missense possibly damaging 0.93
R7757:Agk UTSW 6 40376278 missense possibly damaging 0.95
R8063:Agk UTSW 6 40329556 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAACCATCAAGTTTTGCAACCG -3'
(R):5'- AGGGCAAAAGTACACATGCC -3'

Sequencing Primer
(F):5'- CATCAAGTTTTGCAACCGTTATTGGG -3'
(R):5'- GTACACATGCCAGCTCCATTC -3'
Posted On2018-08-01