Incidental Mutation 'R6691:Kcnk1'
ID530418
Institutional Source Beutler Lab
Gene Symbol Kcnk1
Ensembl Gene ENSMUSG00000033998
Gene Namepotassium channel, subfamily K, member 1
SynonymsTWIK-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6691 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125995170-126030685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126025231 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 192 (V192A)
Ref Sequence ENSEMBL: ENSMUSP00000046103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046765] [ENSMUST00000212831]
Predicted Effect probably benign
Transcript: ENSMUST00000046765
AA Change: V192A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000046103
Gene: ENSMUSG00000033998
AA Change: V192A

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 49 68 N/A INTRINSIC
Pfam:Ion_trans_2 82 158 6.6e-19 PFAM
Pfam:Ion_trans_2 190 271 1.8e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212178
Predicted Effect probably benign
Transcript: ENSMUST00000212831
AA Change: V192A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the members of the superfamily of potassium channel proteins containing two pore-forming P domains. The product of this gene has not been shown to be a functional channel, however, it may require other non-pore-forming proteins for activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation reduced urinary flow rates and on a low phosphate diet display an attenuated ability to increase renal phosphate reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300009A05Rik A G 9: 63,398,954 Y90H probably damaging Het
Agk A G 6: 40,392,690 D337G probably benign Het
Amn A G 12: 111,275,397 H299R possibly damaging Het
Angptl4 A G 17: 33,780,781 probably null Het
AU040320 G A 4: 126,836,670 M563I possibly damaging Het
Cachd1 T C 4: 100,989,486 M1042T probably benign Het
Calcoco2 A G 11: 96,100,108 S247P unknown Het
Cd209c T A 8: 3,945,680 I41L probably benign Het
Ceacam12 T A 7: 18,069,224 V185D possibly damaging Het
Chpt1 A T 10: 88,485,900 probably benign Het
Clca1 G C 3: 145,013,883 A442G probably damaging Het
Cldn8 T C 16: 88,562,535 I167M possibly damaging Het
Cln3 A G 7: 126,579,434 V143A possibly damaging Het
Dusp11 T C 6: 85,961,525 H4R possibly damaging Het
Ephb3 T A 16: 21,214,473 F69Y probably damaging Het
Gm11099 A T 2: 58,859,473 probably benign Het
Grik2 A T 10: 49,272,925 Y521* probably null Het
Igf2r A G 17: 12,689,008 L2143P probably damaging Het
Olfr1055 A C 2: 86,347,419 S116A probably damaging Het
Olfr1254 A T 2: 89,788,988 Y121* probably null Het
Parp3 A G 9: 106,473,692 S329P probably benign Het
Pld3 A T 7: 27,532,316 N483K probably benign Het
Rbm33 A T 5: 28,352,546 E252D probably damaging Het
Ryr2 T C 13: 11,594,723 T4406A probably benign Het
Sgsm3 A G 15: 81,008,862 D380G possibly damaging Het
Sorl1 G T 9: 42,002,567 D1355E probably damaging Het
Sptbn1 A G 11: 30,113,984 S1945P probably damaging Het
Ube2m A T 7: 13,036,469 F70I probably damaging Het
Ube3b A G 5: 114,408,124 I664V probably benign Het
Ugt1a7c A G 1: 88,095,656 E179G possibly damaging Het
Vps50 T C 6: 3,504,939 probably null Het
Xpo1 T C 11: 23,286,875 L718P probably damaging Het
Zfp354c A G 11: 50,814,775 I491T probably benign Het
Other mutations in Kcnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Kcnk1 APN 8 126025407 missense possibly damaging 0.94
IGL01936:Kcnk1 APN 8 126025087 missense probably damaging 1.00
IGL02447:Kcnk1 APN 8 126025080 missense probably damaging 1.00
IGL02674:Kcnk1 APN 8 126025014 missense probably damaging 1.00
PIT4515001:Kcnk1 UTSW 8 126025342 missense probably damaging 1.00
R0735:Kcnk1 UTSW 8 126025289 missense probably damaging 1.00
R1350:Kcnk1 UTSW 8 126025228 missense probably benign 0.08
R1581:Kcnk1 UTSW 8 125995539 missense possibly damaging 0.50
R1789:Kcnk1 UTSW 8 126025384 missense possibly damaging 0.83
R2035:Kcnk1 UTSW 8 126025369 missense possibly damaging 0.56
R2125:Kcnk1 UTSW 8 125995656 missense probably damaging 0.99
R2906:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R2907:Kcnk1 UTSW 8 125995799 missense probably benign 0.00
R4710:Kcnk1 UTSW 8 126029528 missense probably damaging 1.00
R5698:Kcnk1 UTSW 8 126025405 missense probably damaging 1.00
R6591:Kcnk1 UTSW 8 126025231 missense probably benign 0.01
R6647:Kcnk1 UTSW 8 125995460 start codon destroyed probably null 0.98
R6934:Kcnk1 UTSW 8 126025390 missense probably damaging 1.00
R7059:Kcnk1 UTSW 8 126029727 nonsense probably null
R7082:Kcnk1 UTSW 8 125995548 missense probably damaging 1.00
R7441:Kcnk1 UTSW 8 125995568 missense probably damaging 1.00
R7596:Kcnk1 UTSW 8 125995611 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTCCTTACAGGCTATGGC -3'
(R):5'- TCCGATCTTGTACAGCTCTCGG -3'

Sequencing Primer
(F):5'- GGCAAAGCCTTCTGCATCATC -3'
(R):5'- GTACAGCTCTCGGAACTTCTGG -3'
Posted On2018-08-01